pycom05g30480

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Reverse (-)
30597713 .. 30598211
499 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g30480.1

Sequence Viewer

Length: 306 bp
ATGCTTGGAAAGCTACGGATGTCTATTTTCTGGAGCATTTCACAGATTGTTAATATCATTTTTCTAGAAGAAGTTATGGTCGTTTTAACACTAAAAGTTTCCCAAGAGGCTGAGCAGTTTGTAACTGACAAGAAAGCATTGAAAGCAATAAATCTAATAAATCTAGCAAAGAAAAATGATGCAGCAAGAATTGATTTAAAAGTAGCATTGGGGAAGGAAGGAAAAAAGGAGGCTTCAGTCGATTTCTTTCGGTTCTATTTTCTCAAACTCATGTCTATCTTTTGTTTTAACTTAAGGATTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.63

Weight (kDa)

9.67

Isoelectric Point (pI)

25.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 219
AflII CTTAAG 1 cut(s) 292
AgsI TTSAA 1 cut(s) 142
AluBI AGCT 1 cut(s) 13
AluI AGCT 1 cut(s) 13
ApeKI GCWGC 1 cut(s) 182
BbvI GCAGC 1 cut(s) 194
BfaI CTAG 2 cut(s) 65, 164
BfrI CTTAAG 1 cut(s) 292
BisI GCNGC 1 cut(s) 183
BlpI GCTNAGC 1 cut(s) 111
BlsI GCNGC 1 cut(s) 184
BmsI GCATC 1 cut(s) 169
BpmI CTGGAG 1 cut(s) 52
Bpu1102I GCTNAGC 1 cut(s) 111
BseGI GGATG 1 cut(s) 24
BseMII CTCAG 1 cut(s) 102
BseXI GCAGC 1 cut(s) 194
Bsp1720I GCTNAGC 1 cut(s) 111
BspCNI CTCAG 1 cut(s) 103
BspTI CTTAAG 1 cut(s) 292
BstAFI CTTAAG 1 cut(s) 292
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 24
BstMWI GCNNNNNNNGC 2 cut(s) 10, 143
BstV1I GCAGC 1 cut(s) 194
BtsCI GGATG 1 cut(s) 24
CviAII CATG 1 cut(s) 271
CviJI RGCY 3 cut(s) 13, 110, 233
CviKI_1 RGCY 3 cut(s) 13, 110, 233
DdeI CTNAG 1 cut(s) 111
DraI TTTAAA 1 cut(s) 198
Eco57I CTGAAG 1 cut(s) 219
FaeI CATG 1 cut(s) 274
FaiI YATR 2 cut(s) 77, 272
FatI CATG 1 cut(s) 270
Fnu4HI GCNGC 1 cut(s) 183
FokI GGATG 1 cut(s) 31
Fsp4HI GCNGC 1 cut(s) 183
FspBI CTAG 2 cut(s) 65, 164
GluI GCNGC 1 cut(s) 183
GsuI CTGGAG 1 cut(s) 52
Hin1II CATG 1 cut(s) 274
Hpy188III TCNNGA 2 cut(s) 31, 65
HpyAV CCTTC 2 cut(s) 208, 212
HpyCH4V TGCA 1 cut(s) 182
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 143
HpyF3I CTNAG 1 cut(s) 111
Hsp92II CATG 1 cut(s) 274
LmnI GCTCC 1 cut(s) 33
LpnPI CCDG 1 cut(s) 16
Lsp1109I GCAGC 1 cut(s) 194
LweI GCATC 1 cut(s) 169
MaeI CTAG 2 cut(s) 65, 164
MaeIII GTNAC 1 cut(s) 121
MboII GAAGA 1 cut(s) 80
MluCI AATT 1 cut(s) 189
MnlI CCTC 2 cut(s) 100, 223
MseI TTAA 5 cut(s) 51, 86, 197, 288, 293
MspCI CTTAAG 1 cut(s) 292
MwoI GCNNNNNNNGC 2 cut(s) 10, 143
NlaIII CATG 1 cut(s) 274
PkrI GCNGC 1 cut(s) 184
SaqAI TTAA 5 cut(s) 51, 86, 197, 288, 293
SatI GCNGC 1 cut(s) 183
SetI ASST 1 cut(s) 15
SfaNI GCATC 1 cut(s) 169
SgeI CNNG 8 cut(s) 17, 43, 77, 116, 142, 176, 198, 283
SmlI CTYRAG 1 cut(s) 292
SmoI CTYRAG 1 cut(s) 292
Sse9I AATT 1 cut(s) 189
SspMI CTAG 2 cut(s) 65, 164
TaqI TCGA 1 cut(s) 240
TasI AATT 1 cut(s) 189
Tru1I TTAA 5 cut(s) 51, 86, 197, 288, 293
Tru9I TTAA 5 cut(s) 51, 86, 197, 288, 293
TseI GCWGC 1 cut(s) 182
TspGWI ACGGA 1 cut(s) 31
Vha464I CTTAAG 1 cut(s) 292
XbaI TCTAGA 1 cut(s) 64
XspI CTAG 2 cut(s) 65, 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.