pycom17g12380

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
10078300 .. 10078530
231 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g12380.1

Sequence Viewer

Length: 231 bp
ATGTCTATTTTCTGGAGCATTTTGCGGATTGTTAATATCATTTTTCTAGAAGAAGTTATGGCTGTTTTAACACTGAAAGGTTCCCAAGAGGCTGGGCAGTTTGTAATTGACAAGAAAACATTGAAAGCAATAAATCCCATAAAACTAACAGCCAAAACTGATGCAATCAAGAACAAACCAGCTGACACCTATTCAAATATCAGAGGAAATGGAATTAAAGATGAGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

77

Amino Acids

8.48

Weight (kDa)

9.05

Isoelectric Point (pI)

30.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 25
AgsI TTSAA 2 cut(s) 124, 195
AluBI AGCT 1 cut(s) 182
AluI AGCT 1 cut(s) 182
BfaI CTAG 1 cut(s) 47
BmiI GGNNCC 1 cut(s) 82
BmsI GCATC 1 cut(s) 151
BpmI CTGGAG 1 cut(s) 34
BseYI CCCAGC 1 cut(s) 92
BspACI CCGC 1 cut(s) 25
BspLI GGNNCC 1 cut(s) 82
BstXI CCANNNNNNTGG 1 cut(s) 92
BtsIMutI CAGTG 1 cut(s) 71
CviJI RGCY 4 cut(s) 62, 92, 152, 182
CviKI_1 RGCY 4 cut(s) 62, 92, 152, 182
FaiI YATR 2 cut(s) 59, 140
FspBI CTAG 1 cut(s) 47
GsaI CCCAGC 1 cut(s) 96
GsuI CTGGAG 1 cut(s) 34
Hpy188I TCNGA 1 cut(s) 203
Hpy188III TCNNGA 3 cut(s) 13, 47, 169
HpyCH4V TGCA 1 cut(s) 164
LmnI GCTCC 1 cut(s) 15
LpnPI CCDG 2 cut(s) 78, 192
LweI GCATC 1 cut(s) 151
MaeI CTAG 1 cut(s) 47
MboII GAAGA 1 cut(s) 62
MluCI AATT 2 cut(s) 105, 213
MnlI CCTC 3 cut(s) 82, 197, 217
MseI TTAA 4 cut(s) 33, 68, 216, 229
MspA1I CMGCKG 1 cut(s) 182
NlaIV GGNNCC 1 cut(s) 82
PspFI CCCAGC 1 cut(s) 92
PspN4I GGNNCC 1 cut(s) 82
PvuII CAGCTG 1 cut(s) 182
SaqAI TTAA 4 cut(s) 33, 68, 216, 229
SetI ASST 3 cut(s) 82, 184, 191
SfaNI GCATC 1 cut(s) 151
SgeI CNNG 7 cut(s) 25, 59, 98, 105, 124, 181, 191
Sse9I AATT 2 cut(s) 105, 213
SsiI CCGC 1 cut(s) 25
SspMI CTAG 1 cut(s) 47
TasI AATT 2 cut(s) 105, 213
Tru1I TTAA 4 cut(s) 33, 68, 216, 229
Tru9I TTAA 4 cut(s) 33, 68, 216, 229
TscAI CASTG 1 cut(s) 78
TspRI CASTG 1 cut(s) 78
XbaI TCTAGA 1 cut(s) 46
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.