pycom04g10220

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Forward (+)
13011684 .. 13012010
327 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g10220.1

Sequence Viewer

Length: 327 bp
ATGTGCAGGTTAGCTGACTTTGGAAGCAAGTTGCGGACAGCTCAGAATGAATTAGAGAATGAGCCTTATATGCTTGGAAAGCTACCGATGTCTATTTTCTGGGGCATTTCGCGGATTGTTAATTTCATTTTTCTACAAGAAGTTATGGCTGTTTTAATACTAAAAGGTTCCCAAGAGGCTGAGCAGTTTGTAACTGACAAGAAAGCATTGAAAGCAATAAATCCAATAAATCTAGTAGCCAAAACTGATGCAATCAAGAAAAACCAGCTGACACCTATTCAAATATTAGAGGAAATGGAATTAAAGATGAGGATTAAAGGGGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

109

Amino Acids

12.32

Weight (kDa)

8.76

Isoelectric Point (pI)

27.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 112
AciI CCGC 2 cut(s) 34, 112
AgsI TTSAA 2 cut(s) 211, 281
AluBI AGCT 4 cut(s) 14, 41, 82, 268
AluI AGCT 4 cut(s) 14, 41, 82, 268
BfaI CTAG 1 cut(s) 233
BlpI GCTNAGC 1 cut(s) 180
BmiI GGNNCC 1 cut(s) 169
BmsI GCATC 1 cut(s) 238
Bpu1102I GCTNAGC 1 cut(s) 180
BseMII CTCAG 2 cut(s) 56, 171
BsgI GTGCAG 1 cut(s) 25
Bsh1236I CGCG 1 cut(s) 112
Bsp1720I GCTNAGC 1 cut(s) 180
BspACI CCGC 2 cut(s) 34, 112
BspCNI CTCAG 2 cut(s) 55, 172
BspFNI CGCG 1 cut(s) 112
BspLI GGNNCC 1 cut(s) 169
BstDEI CTNAG 2 cut(s) 42, 180
BstFNI CGCG 1 cut(s) 112
BstMWI GCNNNNNNNGC 3 cut(s) 70, 79, 212
BstUI CGCG 1 cut(s) 112
CviJI RGCY 8 cut(s) 14, 41, 64, 82, 149, 179, 239, 268
CviKI_1 RGCY 8 cut(s) 14, 41, 64, 82, 149, 179, 239, 268
DdeI CTNAG 2 cut(s) 42, 180
FaiI YATR 3 cut(s) 69, 71, 146
FspBI CTAG 1 cut(s) 233
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 256
HpyCH4V TGCA 2 cut(s) 6, 251
HpyF10VI GCNNNNNNNGC 3 cut(s) 70, 79, 212
HpyF3I CTNAG 2 cut(s) 42, 180
LpnPI CCDG 2 cut(s) 85, 278
LweI GCATC 1 cut(s) 238
MaeI CTAG 1 cut(s) 233
MaeIII GTNAC 1 cut(s) 190
MluCI AATT 3 cut(s) 50, 121, 299
MnlI CCTC 3 cut(s) 169, 283, 303
MseI TTAA 4 cut(s) 120, 155, 302, 315
MspA1I CMGCKG 1 cut(s) 268
MvnI CGCG 1 cut(s) 112
MwoI GCNNNNNNNGC 3 cut(s) 70, 79, 212
NlaIV GGNNCC 1 cut(s) 169
PspN4I GGNNCC 1 cut(s) 169
PvuII CAGCTG 1 cut(s) 268
SaqAI TTAA 4 cut(s) 120, 155, 302, 315
SetI ASST 7 cut(s) 11, 16, 43, 84, 169, 270, 277
SfaNI GCATC 1 cut(s) 238
Sse9I AATT 3 cut(s) 50, 121, 299
SsiI CCGC 2 cut(s) 34, 112
SspI AATATT 1 cut(s) 285
SspMI CTAG 1 cut(s) 233
TasI AATT 3 cut(s) 50, 121, 299
Tru1I TTAA 4 cut(s) 120, 155, 302, 315
Tru9I TTAA 4 cut(s) 120, 155, 302, 315
TspDTI ATGAA 2 cut(s) 63, 115
XspI CTAG 1 cut(s) 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.