Prupe.7G018600_v2.0.a1

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
OG0003481
Physical Location & Seq
Reverse (-)
2762596 .. 2762808
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G018600.1

Sequence Viewer

Length: 213 bp
ATGCTTGGAAAGCTACAGATGTCTATTCTCTGGAGCATTTCGTGGATTGTTCATATCATTTTTCTAGAAGCAGTTATGGCCATTTTAACACTGAAAGGTTCACAAGAGGCTGAGCAGTTTGTAACTGCAATGAAAGCAATAAACCCAATAAATCTAACAGCCAAAACGGATGCAGCCAAGAACAAGCCAGCGGAAACCTATTCAAATATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Asp_protease_2 RVT_1 Retrotrans_gag rve

Protein Analysis

71

Amino Acids

7.75

Weight (kDa)

8.09

Isoelectric Point (pI)

48.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 191
AcoI YGGCCR 1 cut(s) 78
AgsI TTSAA 1 cut(s) 204
AluBI AGCT 1 cut(s) 13
AluI AGCT 1 cut(s) 13
AoxI GGCC 1 cut(s) 78
ApeKI GCWGC 1 cut(s) 173
BalI TGGCCA 1 cut(s) 80
BbvI GCAGC 1 cut(s) 185
BfaI CTAG 1 cut(s) 65
BfmI CTRYAG 1 cut(s) 14
BisI GCNGC 1 cut(s) 174
BlpI GCTNAGC 1 cut(s) 111
BlsI GCNGC 1 cut(s) 175
BmsI GCATC 1 cut(s) 160
BpmI CTGGAG 1 cut(s) 52
Bpu1102I GCTNAGC 1 cut(s) 111
Bse3DI GCAATG 1 cut(s) 135
BseGI GGATG 1 cut(s) 175
BseMI GCAATG 1 cut(s) 135
BseMII CTCAG 1 cut(s) 102
BseXI GCAGC 1 cut(s) 185
BshFI GGCC 1 cut(s) 80
BsnI GGCC 1 cut(s) 80
Bsp1720I GCTNAGC 1 cut(s) 111
BspACI CCGC 1 cut(s) 191
BspANI GGCC 1 cut(s) 80
BspCNI CTCAG 1 cut(s) 103
BsrDI GCAATG 1 cut(s) 135
BstC8I GCNNGC 1 cut(s) 189
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 175
BstMWI GCNNNNNNNGC 3 cut(s) 10, 77, 134
BstSFI CTRYAG 1 cut(s) 14
BstV1I GCAGC 1 cut(s) 185
BsuRI GGCC 1 cut(s) 80
BtsCI GGATG 1 cut(s) 175
BtsIMutI CAGTG 1 cut(s) 89
Cac8I GCNNGC 1 cut(s) 189
CviJI RGCY 6 cut(s) 13, 80, 110, 161, 176, 187
CviKI_1 RGCY 6 cut(s) 13, 80, 110, 161, 176, 187
DdeI CTNAG 1 cut(s) 111
EaeI YGGCCR 1 cut(s) 78
FaiI YATR 2 cut(s) 54, 77
Fnu4HI GCNGC 1 cut(s) 174
FokI GGATG 1 cut(s) 182
Fsp4HI GCNGC 1 cut(s) 174
FspBI CTAG 1 cut(s) 65
GluI GCNGC 1 cut(s) 174
GsuI CTGGAG 1 cut(s) 52
HaeIII GGCC 1 cut(s) 80
Hpy166II GTNNAC 1 cut(s) 101
Hpy188III TCNNGA 2 cut(s) 31, 65
Hpy8I GTNNAC 1 cut(s) 101
HpyCH4V TGCA 2 cut(s) 128, 173
HpyF10VI GCNNNNNNNGC 3 cut(s) 10, 77, 134
HpyF3I CTNAG 1 cut(s) 111
LmnI GCTCC 1 cut(s) 33
LpnPI CCDG 2 cut(s) 16, 201
Lsp1109I GCAGC 1 cut(s) 185
LweI GCATC 1 cut(s) 160
MaeI CTAG 1 cut(s) 65
MaeIII GTNAC 1 cut(s) 121
MlsI TGGCCA 1 cut(s) 80
MluNI TGGCCA 1 cut(s) 80
MnlI CCTC 1 cut(s) 100
Mox20I TGGCCA 1 cut(s) 80
MscI TGGCCA 1 cut(s) 80
MseI TTAA 1 cut(s) 86
Msp20I TGGCCA 1 cut(s) 80
MspA1I CMGCKG 1 cut(s) 191
MwoI GCNNNNNNNGC 3 cut(s) 10, 77, 134
PkrI GCNGC 1 cut(s) 175
SaqAI TTAA 1 cut(s) 86
SatI GCNGC 1 cut(s) 174
SetI ASST 3 cut(s) 15, 100, 200
SfaNI GCATC 1 cut(s) 160
SfcI CTRYAG 1 cut(s) 14
SgeI CNNG 8 cut(s) 17, 43, 54, 77, 116, 190, 196, 200
SsiI CCGC 1 cut(s) 191
SspI AATATT 1 cut(s) 208
SspMI CTAG 1 cut(s) 65
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TscAI CASTG 1 cut(s) 96
TseI GCWGC 1 cut(s) 173
TspDTI ATGAA 2 cut(s) 41, 146
TspGWI ACGGA 1 cut(s) 182
TspRI CASTG 1 cut(s) 96
XbaI TCTAGA 1 cut(s) 64
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.