pycom05g08660

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Reverse (-)
11336146 .. 11336376
231 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g08660.1

Sequence Viewer

Length: 231 bp
ATGTCTATTTTCTGGGGCATTTCGCAGATTGTTAATATCATTTTTCTAGAAGAAGTTATGGCCGTTTTAACACTGAAAGGTTTCCAAGAGGCTGAGCAGTTTGTAACTGACAAGAAAGCATTGAAAGCAATAAATCCAATAAATCTAGTAGCCAAAACTGATGCAATCAAGAACAAACCAGCTGACACCTATTCAAATATCAGAGGAAATGGAATTAAAGATGAGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

77

Amino Acids

8.47

Weight (kDa)

5.31

Isoelectric Point (pI)

26.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 60
AgsI TTSAA 2 cut(s) 124, 195
AluBI AGCT 1 cut(s) 182
AluI AGCT 1 cut(s) 182
AoxI GGCC 1 cut(s) 60
Asp700I GAANNNNTTC 1 cut(s) 80
BceAI ACGGC 1 cut(s) 47
BfaI CTAG 2 cut(s) 47, 146
BlpI GCTNAGC 1 cut(s) 93
BmsI GCATC 1 cut(s) 151
Bpu1102I GCTNAGC 1 cut(s) 93
BseMII CTCAG 1 cut(s) 84
BshFI GGCC 1 cut(s) 62
BsnI GGCC 1 cut(s) 62
Bsp1720I GCTNAGC 1 cut(s) 93
BspANI GGCC 1 cut(s) 62
BspCNI CTCAG 1 cut(s) 85
BstDEI CTNAG 1 cut(s) 93
BstMWI GCNNNNNNNGC 1 cut(s) 125
BsuRI GGCC 1 cut(s) 62
BtsIMutI CAGTG 1 cut(s) 71
CviJI RGCY 4 cut(s) 62, 92, 152, 182
CviKI_1 RGCY 4 cut(s) 62, 92, 152, 182
DdeI CTNAG 1 cut(s) 93
EaeI YGGCCR 1 cut(s) 60
FaiI YATR 1 cut(s) 59
FspBI CTAG 2 cut(s) 47, 146
HaeIII GGCC 1 cut(s) 62
Hpy188I TCNGA 1 cut(s) 203
Hpy188III TCNNGA 2 cut(s) 47, 169
HpyCH4V TGCA 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 125
HpyF3I CTNAG 1 cut(s) 93
LpnPI CCDG 1 cut(s) 192
LweI GCATC 1 cut(s) 151
MaeI CTAG 2 cut(s) 47, 146
MaeIII GTNAC 1 cut(s) 103
MboII GAAGA 1 cut(s) 62
MluCI AATT 1 cut(s) 213
MnlI CCTC 3 cut(s) 82, 197, 217
MroXI GAANNNNTTC 1 cut(s) 80
MseI TTAA 4 cut(s) 33, 68, 216, 229
MspA1I CMGCKG 1 cut(s) 182
MwoI GCNNNNNNNGC 1 cut(s) 125
PdmI GAANNNNTTC 1 cut(s) 80
PvuII CAGCTG 1 cut(s) 182
SaqAI TTAA 4 cut(s) 33, 68, 216, 229
SetI ASST 3 cut(s) 82, 184, 191
SfaNI GCATC 1 cut(s) 151
SgeI CNNG 7 cut(s) 25, 59, 98, 124, 158, 181, 191
Sse9I AATT 1 cut(s) 213
SspMI CTAG 2 cut(s) 47, 146
TasI AATT 1 cut(s) 213
Tru1I TTAA 4 cut(s) 33, 68, 216, 229
Tru9I TTAA 4 cut(s) 33, 68, 216, 229
TscAI CASTG 1 cut(s) 78
TspRI CASTG 1 cut(s) 78
XbaI TCTAGA 1 cut(s) 46
XmnI GAANNNNTTC 1 cut(s) 80
XspI CTAG 2 cut(s) 47, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.