pycom03g13910

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Forward (+)
15053481 .. 15053711
231 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g13910.1

Sequence Viewer

Length: 231 bp
ATGTCTATTTTCTGCACCATTTCGAAGATTGTTAATATCATTTTTCTAGAAGAAGTTATGGCCATTTTAACACTGAAAGGTTCCCAAGAGGCTAAGCAGTTTGTAACTGACAAGAAAGCATTGAAAGCAATAAATCCAATAAATCTAGTAGCCAAAATTGATGCAATCAAGAACAAACCAACTGACACCTATTCAAATATCAGAGGAAATGGAATTAAAGATGAAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

77

Amino Acids

8.42

Weight (kDa)

8.79

Isoelectric Point (pI)

32.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 60
AgsI TTSAA 2 cut(s) 124, 195
AoxI GGCC 1 cut(s) 60
AsuII TTCGAA 1 cut(s) 23
BalI TGGCCA 1 cut(s) 62
BfaI CTAG 2 cut(s) 47, 146
BlpI GCTNAGC 1 cut(s) 93
BmiI GGNNCC 1 cut(s) 82
BmsI GCATC 1 cut(s) 151
Bpu1102I GCTNAGC 1 cut(s) 93
Bpu14I TTCGAA 1 cut(s) 23
BshFI GGCC 1 cut(s) 62
BsnI GGCC 1 cut(s) 62
Bsp119I TTCGAA 1 cut(s) 23
Bsp1720I GCTNAGC 1 cut(s) 93
BspANI GGCC 1 cut(s) 62
BspLI GGNNCC 1 cut(s) 82
BspT104I TTCGAA 1 cut(s) 23
BstBI TTCGAA 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 93
BstMWI GCNNNNNNNGC 1 cut(s) 125
BsuRI GGCC 1 cut(s) 62
BtsIMutI CAGTG 1 cut(s) 71
CviJI RGCY 3 cut(s) 62, 92, 152
CviKI_1 RGCY 3 cut(s) 62, 92, 152
DdeI CTNAG 1 cut(s) 93
EaeI YGGCCR 1 cut(s) 60
FaiI YATR 1 cut(s) 59
FspBI CTAG 2 cut(s) 47, 146
HaeIII GGCC 1 cut(s) 62
Hpy188I TCNGA 1 cut(s) 203
Hpy188III TCNNGA 2 cut(s) 47, 169
HpyCH4V TGCA 2 cut(s) 15, 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 125
HpyF3I CTNAG 1 cut(s) 93
LweI GCATC 1 cut(s) 151
MaeI CTAG 2 cut(s) 47, 146
MaeIII GTNAC 1 cut(s) 103
MboII GAAGA 2 cut(s) 37, 62
MlsI TGGCCA 1 cut(s) 62
MluCI AATT 2 cut(s) 156, 213
MluNI TGGCCA 1 cut(s) 62
MnlI CCTC 2 cut(s) 82, 197
Mox20I TGGCCA 1 cut(s) 62
MscI TGGCCA 1 cut(s) 62
MseI TTAA 4 cut(s) 33, 68, 216, 229
Msp20I TGGCCA 1 cut(s) 62
MwoI GCNNNNNNNGC 1 cut(s) 125
NlaIV GGNNCC 1 cut(s) 82
NspV TTCGAA 1 cut(s) 23
PspN4I GGNNCC 1 cut(s) 82
SaqAI TTAA 4 cut(s) 33, 68, 216, 229
SetI ASST 2 cut(s) 82, 191
SfaNI GCATC 1 cut(s) 151
SfuI TTCGAA 1 cut(s) 23
SgeI CNNG 5 cut(s) 59, 98, 124, 158, 181
Sse9I AATT 2 cut(s) 156, 213
SspMI CTAG 2 cut(s) 47, 146
TaqI TCGA 1 cut(s) 23
TasI AATT 2 cut(s) 156, 213
Tru1I TTAA 4 cut(s) 33, 68, 216, 229
Tru9I TTAA 4 cut(s) 33, 68, 216, 229
TscAI CASTG 1 cut(s) 78
TspRI CASTG 1 cut(s) 78
XbaI TCTAGA 1 cut(s) 46
XspI CTAG 2 cut(s) 47, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.