pycom05g25790

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Reverse (-)
27136240 .. 27136673
434 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g25790.2

Sequence Viewer

Length: 333 bp
ATGGGACGATCGACAGGTACAAGGCACGTCTTGTTGCAAAGGGGTACAGTCAAATCGAGGAGATTGATTATTGATAAGCTTATATTTATATATATTTTATATCAAATTCACTTGTCTTTTCTTAGTTATCGTCAAAACTGCCTGTGTAGGTCAGCTGAGTTTGGAAGCAAGTTGCGGACAACTCAGAATGAATTAGAGAATAAGCCTTACATGGTTGGAAAGCTACGGATGTCTATTTTCTGGAGCATTTCACGGATTGTTAATATCATTTTTCTAGAAGAAGTTATGGCCATTTTAACACTTAAAGGTCCCAAGAGGCTGAGCAGTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.85

Weight (kDa)

10.57

Isoelectric Point (pI)

52.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 175
AcoI YGGCCR 1 cut(s) 288
AcsI RAATTY 1 cut(s) 105
AfaI GTAC 2 cut(s) 19, 46
AjiI CACGTC 1 cut(s) 28
AluBI AGCT 3 cut(s) 79, 155, 223
AluI AGCT 3 cut(s) 79, 155, 223
AoxI GGCC 1 cut(s) 288
ApoI RAATTY 1 cut(s) 105
AspS9I GGNCC 1 cut(s) 308
AvaII GGWCC 1 cut(s) 308
BalI TGGCCA 1 cut(s) 290
BfaI CTAG 1 cut(s) 275
BlpI GCTNAGC 1 cut(s) 320
Bme18I GGWCC 1 cut(s) 308
BmgBI CACGTC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 308
BmiI GGNNCC 1 cut(s) 310
BpmI CTGGAG 1 cut(s) 262
Bpu1102I GCTNAGC 1 cut(s) 320
BseGI GGATG 1 cut(s) 234
BseMII CTCAG 3 cut(s) 147, 197, 311
BseRI GAGGAG 1 cut(s) 73
Bsh1285I CGRYCG 1 cut(s) 11
BshFI GGCC 1 cut(s) 290
BsiEI CGRYCG 1 cut(s) 11
BslFI GGGAC 2 cut(s) 18, 294
BsmFI GGGAC 2 cut(s) 18, 294
BsnI GGCC 1 cut(s) 290
Bsp143I GATC 1 cut(s) 8
Bsp1720I GCTNAGC 1 cut(s) 320
BspACI CCGC 1 cut(s) 175
BspANI GGCC 1 cut(s) 290
BspCNI CTCAG 3 cut(s) 148, 196, 312
BspLI GGNNCC 1 cut(s) 310
BssMI GATC 1 cut(s) 8
Bst4CI ACNGT 1 cut(s) 49
BstDEI CTNAG 4 cut(s) 122, 156, 183, 320
BstF5I GGATG 1 cut(s) 234
BstKTI GATC 1 cut(s) 11
BstMBI GATC 1 cut(s) 8
BstMCI CGRYCG 1 cut(s) 11
BsuRI GGCC 1 cut(s) 290
BtrI CACGTC 1 cut(s) 28
BtsCI GGATG 1 cut(s) 234
Cfr13I GGNCC 1 cut(s) 308
Csp6I GTAC 2 cut(s) 18, 45
CviAII CATG 1 cut(s) 211
CviJI RGCY 6 cut(s) 79, 155, 205, 223, 290, 319
CviKI_1 RGCY 6 cut(s) 79, 155, 205, 223, 290, 319
CviQI GTAC 2 cut(s) 18, 45
DdeI CTNAG 4 cut(s) 122, 156, 183, 320
DpnI GATC 1 cut(s) 10
DpnII GATC 1 cut(s) 8
EaeI YGGCCR 1 cut(s) 288
Eco47I GGWCC 1 cut(s) 308
EcoO109I RGGNCCY 1 cut(s) 308
FaeI CATG 1 cut(s) 214
FaiI YATR 7 cut(s) 83, 89, 91, 93, 100, 212, 287
FaqI GGGAC 2 cut(s) 18, 294
FatI CATG 1 cut(s) 210
FokI GGATG 1 cut(s) 241
FspBI CTAG 1 cut(s) 275
GsuI CTGGAG 1 cut(s) 262
HaeIII GGCC 1 cut(s) 290
Hin1II CATG 1 cut(s) 214
HindIII AAGCTT 1 cut(s) 77
Hpy188I TCNGA 1 cut(s) 186
Hpy188III TCNNGA 2 cut(s) 241, 275
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4IV ACGT 1 cut(s) 27
HpyCH4V TGCA 1 cut(s) 37
HpyF3I CTNAG 4 cut(s) 122, 156, 183, 320
HpySE526I ACGT 1 cut(s) 27
Hsp92II CATG 1 cut(s) 214
Kzo9I GATC 1 cut(s) 8
LmnI GCTCC 1 cut(s) 243
LpnPI CCDG 2 cut(s) 155, 226
MaeI CTAG 1 cut(s) 275
MaeII ACGT 1 cut(s) 27
MalI GATC 1 cut(s) 10
MboI GATC 1 cut(s) 8
MboII GAAGA 1 cut(s) 290
MlsI TGGCCA 1 cut(s) 290
MluCI AATT 2 cut(s) 105, 191
MluNI TGGCCA 1 cut(s) 290
MmeI TCCRAC 1 cut(s) 196
MnlI CCTC 2 cut(s) 51, 309
Mox20I TGGCCA 1 cut(s) 290
MscI TGGCCA 1 cut(s) 290
MseI TTAA 3 cut(s) 261, 296, 303
Msp20I TGGCCA 1 cut(s) 290
MspA1I CMGCKG 1 cut(s) 155
NdeII GATC 1 cut(s) 8
NlaIII CATG 1 cut(s) 214
NlaIV GGNNCC 1 cut(s) 310
Ple19I CGATCG 1 cut(s) 11
PpuMI RGGWCCY 1 cut(s) 308
Psp5II RGGWCCY 1 cut(s) 308
PspN4I GGNNCC 1 cut(s) 310
PspPI GGNCC 1 cut(s) 308
PspPPI RGGWCCY 1 cut(s) 308
PvuI CGATCG 1 cut(s) 11
PvuII CAGCTG 1 cut(s) 155
RsaI GTAC 2 cut(s) 19, 46
RsaNI GTAC 2 cut(s) 18, 45
SaqAI TTAA 3 cut(s) 261, 296, 303
Sau3AI GATC 1 cut(s) 8
Sau96I GGNCC 1 cut(s) 308
SetI ASST 7 cut(s) 19, 30, 81, 152, 157, 225, 310
SinI GGWCC 1 cut(s) 308
Sse9I AATT 2 cut(s) 105, 191
SsiI CCGC 1 cut(s) 175
SspMI CTAG 1 cut(s) 275
TaaI ACNGT 1 cut(s) 49
TaiI ACGT 1 cut(s) 30
TaqI TCGA 2 cut(s) 11, 56
TasI AATT 2 cut(s) 105, 191
Tru1I TTAA 3 cut(s) 261, 296, 303
Tru9I TTAA 3 cut(s) 261, 296, 303
TspDTI ATGAA 1 cut(s) 204
TspGWI ACGGA 2 cut(s) 241, 268
VpaK11BI GGWCC 1 cut(s) 308
XapI RAATTY 1 cut(s) 105
XbaI TCTAGA 1 cut(s) 274
XspI CTAG 1 cut(s) 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.