pycom07g00140

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Reverse (-)
156070 .. 156459
390 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g00140.1

Sequence Viewer

Length: 390 bp
ATGTCAGCTGACTTTGGAAGCAAGTTAGGAACAGCTCAGAATGAATTAGAGAATGAGCTTTATATGCTTGGAAAGCTACGGATGTCTATTTTCTGGAGCATTTCACGGATTGTTAATATCATTTTTCTAGAAGAAGTTATGGCCGTTTTAACACTAAAAGGTTCCCAAGAGGCTGAACAGTTTGTAACTGACAAGAAAGCATTGAAAGCAATAAATCCAATAAAACTAGCAGCCAAAACTGATGCAGCCAAGAACAAGCCAACTGACACCTATTCAAATATCAGAGGAAATGGAAAATTAAGTGGAAGTAATGGACATAAAGGCTGCCTAAAGAGTTACAATTGTTTTAGCATTTCCTCTCACTTATTGTCATCACTAAATGGCTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

130

Amino Acids

14.06

Weight (kDa)

9.2

Isoelectric Point (pI)

26.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 141
AgsI TTSAA 2 cut(s) 205, 276
AluBI AGCT 4 cut(s) 8, 35, 58, 76
AluI AGCT 4 cut(s) 8, 35, 58, 76
AoxI GGCC 1 cut(s) 141
ApeKI GCWGC 3 cut(s) 230, 245, 324
BbvI GCAGC 3 cut(s) 242, 257, 311
BceAI ACGGC 1 cut(s) 128
BfaI CTAG 2 cut(s) 128, 227
BisI GCNGC 3 cut(s) 231, 246, 325
BlsI GCNGC 3 cut(s) 232, 247, 326
BmiI GGNNCC 1 cut(s) 163
BmsI GCATC 1 cut(s) 232
BpmI CTGGAG 1 cut(s) 115
BseGI GGATG 1 cut(s) 87
BseMII CTCAG 1 cut(s) 50
BseXI GCAGC 3 cut(s) 242, 257, 311
BshFI GGCC 1 cut(s) 143
BsnI GGCC 1 cut(s) 143
BspANI GGCC 1 cut(s) 143
BspCNI CTCAG 1 cut(s) 49
BspLI GGNNCC 1 cut(s) 163
Bst4CI ACNGT 1 cut(s) 180
BstDEI CTNAG 1 cut(s) 36
BstF5I GGATG 1 cut(s) 87
BstMWI GCNNNNNNNGC 3 cut(s) 64, 73, 206
BstV1I GCAGC 3 cut(s) 242, 257, 311
BsuRI GGCC 1 cut(s) 143
BtsCI GGATG 1 cut(s) 87
DdeI CTNAG 1 cut(s) 36
EaeI YGGCCR 1 cut(s) 141
FaiI YATR 4 cut(s) 63, 65, 140, 318
Fnu4HI GCNGC 3 cut(s) 231, 246, 325
FokI GGATG 1 cut(s) 94
Fsp4HI GCNGC 3 cut(s) 231, 246, 325
FspBI CTAG 2 cut(s) 128, 227
GluI GCNGC 3 cut(s) 231, 246, 325
GsuI CTGGAG 1 cut(s) 115
HaeIII GGCC 1 cut(s) 143
Hpy188I TCNGA 2 cut(s) 39, 284
Hpy188III TCNNGA 2 cut(s) 94, 128
HpyCH4III ACNGT 1 cut(s) 180
HpyCH4V TGCA 1 cut(s) 245
HpyF10VI GCNNNNNNNGC 3 cut(s) 64, 73, 206
HpyF3I CTNAG 1 cut(s) 36
LmnI GCTCC 1 cut(s) 96
LpnPI CCDG 1 cut(s) 79
Lsp1109I GCAGC 3 cut(s) 242, 257, 311
LweI GCATC 1 cut(s) 232
MaeI CTAG 2 cut(s) 128, 227
MaeIII GTNAC 2 cut(s) 184, 335
MboII GAAGA 1 cut(s) 143
MfeI CAATTG 1 cut(s) 340
MluCI AATT 3 cut(s) 44, 296, 340
MnlI CCTC 3 cut(s) 163, 278, 367
MseI TTAA 3 cut(s) 114, 149, 299
MspA1I CMGCKG 1 cut(s) 8
MunI CAATTG 1 cut(s) 340
MwoI GCNNNNNNNGC 3 cut(s) 64, 73, 206
NlaIV GGNNCC 1 cut(s) 163
PkrI GCNGC 3 cut(s) 232, 247, 326
PspN4I GGNNCC 1 cut(s) 163
PvuII CAGCTG 1 cut(s) 8
SaqAI TTAA 3 cut(s) 114, 149, 299
SatI GCNGC 3 cut(s) 231, 246, 325
SetI ASST 6 cut(s) 10, 37, 60, 78, 163, 272
SfaNI GCATC 1 cut(s) 232
Sse9I AATT 3 cut(s) 44, 296, 340
SspMI CTAG 2 cut(s) 128, 227
TaaI ACNGT 1 cut(s) 180
TasI AATT 3 cut(s) 44, 296, 340
Tru1I TTAA 3 cut(s) 114, 149, 299
Tru9I TTAA 3 cut(s) 114, 149, 299
TseI GCWGC 3 cut(s) 230, 245, 324
TspDTI ATGAA 1 cut(s) 57
TspGWI ACGGA 2 cut(s) 94, 121
XbaI TCTAGA 1 cut(s) 127
XspI CTAG 2 cut(s) 128, 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.