MD14G1016200.v1.1

Phytosulfokines

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0004634
Physical Location & Seq
Reverse (-)
1461086 .. 1462014
929 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1016200.v1.1.491

Sequence Viewer

Length: 249 bp
ATGAAGCAGATGAAGAATAACCAAAACTTTATCATATTTTCTCTCTTTGTTTTTCTTCTTCTCTCCAACTCATCATCTGCACGTGCTCGTCTTCTGCAACAAAACAAAGCTTCACTAACTGGAGCCGATGATCTTGTAAATTTGATGGGAGCAGAAGAATGTGATGAAAATGATGAAGAGTGTCTGCAGAGAAGGATGATTGCTGAAGCTCACTTGGATTATATTTACACCCAAAACCATAAGCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PSK

Protein Analysis

83

Amino Acids

9.44

Weight (kDa)

5.19

Isoelectric Point (pI)

53.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PSK PF06404 19 - 82 2.9e-17 Phytosulfokine precursor protein (PSK)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 139
AcuI CTGAAG 1 cut(s) 225
AcvI CACGTG 1 cut(s) 83
AluBI AGCT 2 cut(s) 110, 209
AluI AGCT 2 cut(s) 110, 209
Alw21I GWGCWC 1 cut(s) 88
ApoI RAATTY 1 cut(s) 139
BbrPI CACGTG 1 cut(s) 83
BbsI GAAGAC 1 cut(s) 83
Bbv12I GWGCWC 1 cut(s) 88
BccI CCATC 1 cut(s) 139
BfmI CTRYAG 1 cut(s) 185
BmiI GGNNCC 1 cut(s) 124
BpiI GAAGAC 1 cut(s) 83
BpmI CTGGAG 1 cut(s) 141
BsaAI YACGTR 1 cut(s) 83
Bse1I ACTGG 1 cut(s) 124
BseGI GGATG 1 cut(s) 201
BseNI ACTGG 1 cut(s) 124
BsgI GTGCAG 1 cut(s) 63
BsiHKAI GWGCWC 1 cut(s) 88
Bsp1286I GDGCHC 1 cut(s) 88
Bsp143I GATC 1 cut(s) 130
BspLI GGNNCC 1 cut(s) 124
BspMAI CTGCAG 1 cut(s) 189
BsrI ACTGG 1 cut(s) 124
BssMI GATC 1 cut(s) 130
Bst6I CTCTTC 1 cut(s) 171
BstBAI YACGTR 1 cut(s) 83
BstF5I GGATG 1 cut(s) 201
BstKTI GATC 1 cut(s) 133
BstMBI GATC 1 cut(s) 130
BstSFI CTRYAG 1 cut(s) 185
BstV2I GAAGAC 1 cut(s) 83
BtsCI GGATG 1 cut(s) 201
CviJI RGCY 4 cut(s) 110, 125, 209, 244
CviKI_1 RGCY 4 cut(s) 110, 125, 209, 244
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
Eam1104I CTCTTC 1 cut(s) 171
EarI CTCTTC 1 cut(s) 171
Eco57I CTGAAG 1 cut(s) 225
Eco72I CACGTG 1 cut(s) 83
FaiI YATR 4 cut(s) 35, 222, 240, 247
FokI GGATG 1 cut(s) 208
GsuI CTGGAG 1 cut(s) 141
HindIII AAGCTT 1 cut(s) 108
HpyAV CCTTC 1 cut(s) 186
HpyCH4IV ACGT 1 cut(s) 82
HpyCH4V TGCA 3 cut(s) 80, 97, 187
HpySE526I ACGT 1 cut(s) 82
Kzo9I GATC 1 cut(s) 130
LmnI GCTCC 2 cut(s) 122, 149
LpnPI CCDG 1 cut(s) 105
MaeII ACGT 1 cut(s) 82
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MboII GAAGA 6 cut(s) 25, 47, 50, 83, 167, 188
MhlI GDGCHC 1 cut(s) 88
MluCI AATT 1 cut(s) 139
MmeI TCCRAC 1 cut(s) 90
NdeII GATC 1 cut(s) 130
NlaIV GGNNCC 1 cut(s) 124
PmaCI CACGTG 1 cut(s) 83
PmlI CACGTG 1 cut(s) 83
Ppu21I YACGTR 1 cut(s) 83
PspCI CACGTG 1 cut(s) 83
PspN4I GGNNCC 1 cut(s) 124
PstI CTGCAG 1 cut(s) 189
Sau3AI GATC 1 cut(s) 130
SduI GDGCHC 1 cut(s) 88
SetI ASST 3 cut(s) 85, 112, 211
SfcI CTRYAG 1 cut(s) 185
SgeI CNNG 6 cut(s) 93, 95, 99, 132, 146, 226
Sse9I AATT 1 cut(s) 139
TaiI ACGT 1 cut(s) 85
TasI AATT 1 cut(s) 139
TspDTI ATGAA 4 cut(s) 17, 26, 180, 189
XapI RAATTY 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.