RchiOBHm_Chr5g0055241

phytosulfokines 6

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
58142712 .. 58143753
1042 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33227

Sequence Viewer

Length: 282 bp
ATGAGGCAAAGCTTTCAAACAACAGCTATTGTTCTTTGCATTTTGTTCATCATTTCTTCCTCAACAATATCAGCCAGGGTTTTACAGAACAAAGAAGGACAAGAGGAAGCAAAGCTCAAGGAAACCAGTGATGGGAATTCACTTACGGAGTTGGAAGGCACTGACTTCATGAATCTAATGGGGCTGGAAGCCTGTGTTGATGGAGATGAAGACTGTTTAAAGAGAAGGGTAATTGCAGAAGCTCACTTGGACTACATCTACACCCAGCACCATAAGCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.45

Weight (kDa)

4.88

Isoelectric Point (pI)

44.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PSK PF06404 14 - 93 1.6e-23 Phytosulfokine precursor protein (PSK)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 136
AfiI CCNNNNNNNGG 1 cut(s) 132
AgsI TTSAA 1 cut(s) 17
AjnI CCWGG 1 cut(s) 74
AluBI AGCT 4 cut(s) 12, 26, 115, 242
AluI AGCT 4 cut(s) 12, 26, 115, 242
ApoI RAATTY 1 cut(s) 136
BbsI GAAGAC 1 cut(s) 216
BccI CCATC 2 cut(s) 125, 194
BciT130I CCWGG 1 cut(s) 76
Bme1390I CCNGG 1 cut(s) 76
BmrFI CCNGG 1 cut(s) 76
BpiI GAAGAC 1 cut(s) 216
BpuEI CTTGAG 1 cut(s) 101
BsaJI CCNNGG 1 cut(s) 75
Bsc4I CCNNNNNNNGG 1 cut(s) 132
Bse1I ACTGG 1 cut(s) 126
BseBI CCWGG 1 cut(s) 76
BseDI CCNNGG 1 cut(s) 75
BseLI CCNNNNNNNGG 1 cut(s) 132
BseNI ACTGG 1 cut(s) 126
BseYI CCCAGC 1 cut(s) 264
BslI CCNNNNNNNGG 1 cut(s) 132
BspHI TCATGA 1 cut(s) 168
BsrI ACTGG 1 cut(s) 126
BssECI CCNNGG 1 cut(s) 75
Bst2UI CCWGG 1 cut(s) 76
Bst4CI ACNGT 1 cut(s) 215
BstMWI GCNNNNNNNGC 1 cut(s) 274
BstNI CCWGG 1 cut(s) 76
BstSCI CCNGG 1 cut(s) 74
BstV2I GAAGAC 1 cut(s) 216
BtsIMutI CAGTG 2 cut(s) 133, 159
CciI TCATGA 1 cut(s) 168
CviAII CATG 1 cut(s) 169
CviJI RGCY 8 cut(s) 12, 26, 74, 115, 184, 191, 242, 277
CviKI_1 RGCY 8 cut(s) 12, 26, 74, 115, 184, 191, 242, 277
DraI TTTAAA 1 cut(s) 219
EcoRI GAATTC 1 cut(s) 136
EcoRII CCWGG 1 cut(s) 74
FaeI CATG 1 cut(s) 172
FaiI YATR 2 cut(s) 170, 273
FatI CATG 1 cut(s) 168
GsaI CCCAGC 1 cut(s) 268
Hin1II CATG 1 cut(s) 172
HindIII AAGCTT 1 cut(s) 10
HinfI GANTC 1 cut(s) 172
Hpy188III TCNNGA 1 cut(s) 169
HpyAV CCTTC 3 cut(s) 89, 149, 219
HpyCH4III ACNGT 1 cut(s) 215
HpyCH4V TGCA 2 cut(s) 39, 236
HpyF10VI GCNNNNNNNGC 1 cut(s) 274
Hsp92II CATG 1 cut(s) 172
LpnPI CCDG 6 cut(s) 61, 88, 139, 170, 205, 278
MboII GAAGA 2 cut(s) 48, 221
MluCI AATT 2 cut(s) 136, 231
MmeI TCCRAC 1 cut(s) 132
MnlI CCTC 2 cut(s) 70, 97
MseI TTAA 1 cut(s) 218
MspR9I CCNGG 1 cut(s) 76
MvaI CCWGG 1 cut(s) 76
MwoI GCNNNNNNNGC 1 cut(s) 274
NlaIII CATG 1 cut(s) 172
PagI TCATGA 1 cut(s) 168
PfeI GAWTC 1 cut(s) 172
Psp6I CCWGG 1 cut(s) 74
PspFI CCCAGC 1 cut(s) 264
PspGI CCWGG 1 cut(s) 74
SaqAI TTAA 1 cut(s) 218
ScrFI CCNGG 1 cut(s) 76
SetI ASST 4 cut(s) 14, 28, 117, 244
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 2 cut(s) 136, 231
StyD4I CCNGG 1 cut(s) 74
TaaI ACNGT 1 cut(s) 215
TasI AATT 2 cut(s) 136, 231
TfiI GAWTC 1 cut(s) 172
Tru1I TTAA 1 cut(s) 218
Tru9I TTAA 1 cut(s) 218
TscAI CASTG 2 cut(s) 133, 166
TspDTI ATGAA 4 cut(s) 37, 157, 185, 222
TspGWI ACGGA 1 cut(s) 161
TspRI CASTG 2 cut(s) 133, 166
XapI RAATTY 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.