Prupe.7G116900_v2.0.a1

Phytosulfokines

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
14189550 .. 14190256
707 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G116900.1

Sequence Viewer

Length: 237 bp
ATGAAACAAAACTACCAAGGCTTTCTCATGTTCTCTGTCTTTGCTTTTCTTATTTTCTCCACCTCATCACATGCTCGTCTTCTGCAACAACACCAAGCTTCATTATCTGCAACAAATGATCCTATAGATCTGATGGGATCAGAAGAATGTGATGACAGAGATGAAGAGTGTCTGAACAGAAGGTTGATTGCAGAAGCTCACTTGGATTATATTTACACCCAAAACCATAAGCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

9.05

Weight (kDa)

5.09

Isoelectric Point (pI)

52.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 113, 145
AluBI AGCT 2 cut(s) 98, 197
AluI AGCT 2 cut(s) 98, 197
AlwI GGATC 2 cut(s) 113, 145
BbsI GAAGAC 1 cut(s) 71
BccI CCATC 1 cut(s) 127
BfmI CTRYAG 1 cut(s) 123
BglII AGATCT 1 cut(s) 127
BpiI GAAGAC 1 cut(s) 71
BsaJI CCNNGG 1 cut(s) 16
BseDI CCNNGG 1 cut(s) 16
Bsp143I GATC 3 cut(s) 118, 127, 137
BspPI GGATC 2 cut(s) 113, 145
BssECI CCNNGG 1 cut(s) 16
BssMI GATC 3 cut(s) 118, 127, 137
BssT1I CCWWGG 1 cut(s) 16
Bst6I CTCTTC 1 cut(s) 159
BstKTI GATC 3 cut(s) 121, 130, 140
BstMBI GATC 3 cut(s) 118, 127, 137
BstNSI RCATGY 1 cut(s) 74
BstSFI CTRYAG 1 cut(s) 123
BstV2I GAAGAC 1 cut(s) 71
BstX2I RGATCY 1 cut(s) 127
BstYI RGATCY 1 cut(s) 127
CviAII CATG 2 cut(s) 28, 71
CviJI RGCY 4 cut(s) 21, 98, 197, 232
CviKI_1 RGCY 4 cut(s) 21, 98, 197, 232
DpnI GATC 3 cut(s) 120, 129, 139
DpnII GATC 3 cut(s) 118, 127, 137
Eam1104I CTCTTC 1 cut(s) 159
EarI CTCTTC 1 cut(s) 159
Eco130I CCWWGG 1 cut(s) 16
EcoT14I CCWWGG 1 cut(s) 16
ErhI CCWWGG 1 cut(s) 16
FaeI CATG 2 cut(s) 31, 74
FaiI YATR 6 cut(s) 29, 72, 125, 210, 228, 235
FatI CATG 2 cut(s) 27, 70
Hin1II CATG 2 cut(s) 31, 74
HindIII AAGCTT 1 cut(s) 96
Hpy188I TCNGA 3 cut(s) 132, 142, 174
HpyAV CCTTC 1 cut(s) 174
HpyCH4V TGCA 3 cut(s) 85, 110, 191
Hsp92II CATG 2 cut(s) 31, 74
Kzo9I GATC 3 cut(s) 118, 127, 137
MalI GATC 3 cut(s) 120, 129, 139
MboI GATC 3 cut(s) 118, 127, 137
MboII GAAGA 3 cut(s) 71, 155, 176
MflI RGATCY 1 cut(s) 127
MnlI CCTC 1 cut(s) 73
NdeII GATC 3 cut(s) 118, 127, 137
NlaIII CATG 2 cut(s) 31, 74
NspI RCATGY 1 cut(s) 74
PsuI RGATCY 1 cut(s) 127
Sau3AI GATC 3 cut(s) 118, 127, 137
SetI ASST 4 cut(s) 65, 100, 185, 199
SfcI CTRYAG 1 cut(s) 123
SgeI CNNG 6 cut(s) 29, 40, 83, 87, 107, 214
StyI CCWWGG 1 cut(s) 16
TspDTI ATGAA 3 cut(s) 17, 90, 177
XceI RCATGY 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.