Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011582.1

Orthogroup ID

OG0004634

Physical Location & Seq

Genomic Coordinates Forward (+)

96400 .. 96856

Gene Structure 457 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011582.1_g000019.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 282 bp

atgaggcaaagctttcaaacaacagctattgttcttggcattttgttcatcatttcttcctcaacaatatcagccagggttttacagaacaaaaaaggacaagaggaggcaaagctcaaggaaaccagtgatgggaattcacttacggagttggaaggcactgacttcatgaatctaatggggctggaagcctgtgttgatggagatgaagactgtttaaagagaagggtaattgcagaagctcacttggactacatctacacccagcaccataagccttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PSK

Protein Analysis

93

Amino Acids

10.4

Weight (kDa)

5.25

Isoelectric Point (pI)

42.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004634)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G44735 AT3G44735
fragaria_vesca	FvH4_3g29900 FvH4_3g29900 FvH4_3g29900 FvH4_6g17920
malus_domestica	MD03G1134700.v1.1 MD11G1157500.v1.1 MD12G1018200.v1.1 MD14G1016200.v1.1
prunus_persica	Prupe.7G116900_v2.0.a1
pyrus_communis	pycom03g09070 pycom14g01400
rosa_chinensis	RchiOBHm_Chr3g0472171 RchiOBHm_Chr5g0055241
rosa_multiflora	Rmu_sc0002532.1_g000031 Rmu_sc0003110.1_g000017 Rmu_sc0011582.1_g000019
rosa_roxburghii	Rroxscaffold_1G00025060 Rroxscaffold_6G00409170
rosa_rugosa	Rorug03G0122800 Rorug05G0292000
rosa_samantha	Rh3AG174800 Rh3CG191300 Rh3CG198700 Rh3DG174600 Rh5AG361800 Rh5BG373400 Rh5CG395100 Rh5DG386600
rosa_wichuraiana	Rw5G034020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	136
AfiI	CCNNNNNNNGG	1 cut(s)	132
AgsI	TTSAA	1 cut(s)	17
AjnI	CCWGG	1 cut(s)	74
AluBI	AGCT	4 cut(s)	12, 26, 115, 242
AluI	AGCT	4 cut(s)	12, 26, 115, 242
ApoI	RAATTY	1 cut(s)	136
BbsI	GAAGAC	1 cut(s)	216
BccI	CCATC	2 cut(s)	125, 194
BciT130I	CCWGG	1 cut(s)	76
Bme1390I	CCNGG	1 cut(s)	76
BmrFI	CCNGG	1 cut(s)	76
BpiI	GAAGAC	1 cut(s)	216
BpuEI	CTTGAG	1 cut(s)	101
BsaJI	CCNNGG	1 cut(s)	75
Bsc4I	CCNNNNNNNGG	1 cut(s)	132
Bse1I	ACTGG	1 cut(s)	126
BseBI	CCWGG	1 cut(s)	76
BseDI	CCNNGG	1 cut(s)	75
BseLI	CCNNNNNNNGG	1 cut(s)	132
BseNI	ACTGG	1 cut(s)	126
BseRI	GAGGAG	1 cut(s)	119
BseYI	CCCAGC	1 cut(s)	264
BslI	CCNNNNNNNGG	1 cut(s)	132
BspHI	TCATGA	1 cut(s)	168
BsrI	ACTGG	1 cut(s)	126
BssECI	CCNNGG	1 cut(s)	75
Bst2UI	CCWGG	1 cut(s)	76
Bst4CI	ACNGT	1 cut(s)	215
BstMWI	GCNNNNNNNGC	1 cut(s)	274
BstNI	CCWGG	1 cut(s)	76
BstSCI	CCNGG	1 cut(s)	74
BstV2I	GAAGAC	1 cut(s)	216
BtsIMutI	CAGTG	2 cut(s)	133, 159
CciI	TCATGA	1 cut(s)	168
CviAII	CATG	1 cut(s)	169
CviJI	RGCY	8 cut(s)	12, 26, 74, 115, 184, 191, 242, 277
CviKI_1	RGCY	8 cut(s)	12, 26, 74, 115, 184, 191, 242, 277
DraI	TTTAAA	1 cut(s)	219
EcoRI	GAATTC	1 cut(s)	136
EcoRII	CCWGG	1 cut(s)	74
FaeI	CATG	1 cut(s)	172
FaiI	YATR	2 cut(s)	170, 273
FatI	CATG	1 cut(s)	168
GsaI	CCCAGC	1 cut(s)	268
Hin1II	CATG	1 cut(s)	172
HindIII	AAGCTT	1 cut(s)	10
HinfI	GANTC	1 cut(s)	172
Hpy188III	TCNNGA	1 cut(s)	169
HpyAV	CCTTC	2 cut(s)	149, 219
HpyCH4III	ACNGT	1 cut(s)	215
HpyCH4V	TGCA	1 cut(s)	236
HpyF10VI	GCNNNNNNNGC	1 cut(s)	274
Hsp92II	CATG	1 cut(s)	172
LpnPI	CCDG	6 cut(s)	61, 88, 139, 170, 205, 278
MboII	GAAGA	2 cut(s)	48, 221
MluCI	AATT	2 cut(s)	136, 231
MmeI	TCCRAC	1 cut(s)	132
MnlI	CCTC	3 cut(s)	70, 97, 100
MseI	TTAA	1 cut(s)	218
MspR9I	CCNGG	1 cut(s)	76
MvaI	CCWGG	1 cut(s)	76
MwoI	GCNNNNNNNGC	1 cut(s)	274
NlaIII	CATG	1 cut(s)	172
PagI	TCATGA	1 cut(s)	168
PfeI	GAWTC	1 cut(s)	172
Psp6I	CCWGG	1 cut(s)	74
PspFI	CCCAGC	1 cut(s)	264
PspGI	CCWGG	1 cut(s)	74
SaqAI	TTAA	1 cut(s)	218
ScrFI	CCNGG	1 cut(s)	76
SetI	ASST	4 cut(s)	14, 28, 117, 244
SmlI	CTYRAG	1 cut(s)	116
SmoI	CTYRAG	1 cut(s)	116
Sse9I	AATT	2 cut(s)	136, 231
StyD4I	CCNGG	1 cut(s)	74
TaaI	ACNGT	1 cut(s)	215
TasI	AATT	2 cut(s)	136, 231
TfiI	GAWTC	1 cut(s)	172
Tru1I	TTAA	1 cut(s)	218
Tru9I	TTAA	1 cut(s)	218
TscAI	CASTG	2 cut(s)	133, 166
TspDTI	ATGAA	4 cut(s)	37, 157, 185, 222
TspGWI	ACGGA	1 cut(s)	161
TspRI	CASTG	2 cut(s)	133, 166
XapI	RAATTY	1 cut(s)	136

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.