MD15G1297700.v1.1

E3 ubiquitin-protein ligase that specifically mediates the formation of 'Lys-6'-linked polyubiquitin chains and plays a central role in DNA repair by facilitating cellular responses to DNA damage. It is unclear whether it also mediates the formation of other types of polyubiquitin chains. The E3 ubiquitin-protein ligase activity is required for its tumor suppressor function. The BRCA1-BARD1 heterodimer coordinates a diverse range of cellular pathways such as DNA damage repair, ubiquitination and transcriptional regulation to maintain genomic stability. Regulates centrosomal microtubule nucleation. Required for normal cell cycle progression from G2 to mitosis. Required for appropriate cell cycle arrests after ionizing irradiation in both the S-phase and the G2 phase of the cell cycle. Involved in transcriptional regulation of P21 in response to DNA damage. Required for FANCD2 targeting to sites of DNA damage. May function as a transcriptional regulator

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0013725
Physical Location & Seq
Forward (+)
28065648 .. 28067179
1532 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1297700.v1.1.491

Sequence Viewer

Length: 243 bp
ATGGAAGCTTCACTGAAGAGGAAGACATCACTATCTGCAGCCTCTACAACCAGATGGGAAGCCGACAATTTAAGTCTACTGAGTTATGCGGATTCACTCAAATGCAATCATCTCTTCTGCAACATTTGCACTGTGAAGTCGATGAAATCGGGTTCCTTTTGTCCAGTTTATAAAATTCCATATCGGCGCAGAGGCAAGCAAAATGATGTAAATTGGCGATTTACAGTGGCTTTGAAAGGGTGA

Protein Analysis

81

Amino Acids

9.09

Weight (kDa)

9.84

Isoelectric Point (pI)

43.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-C3HC4_2 PF13923 29 - 56 4.3e-06 Zinc finger, C3HC4 type (RING finger)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 171
AccI GTMKAC 1 cut(s) 76
AciI CCGC 1 cut(s) 89
AcsI RAATTY 1 cut(s) 174
AcuI CTGAAG 1 cut(s) 35
AgsI TTSAA 1 cut(s) 235
AluBI AGCT 1 cut(s) 8
AluI AGCT 1 cut(s) 8
ApeKI GCWGC 1 cut(s) 38
ApoI RAATTY 1 cut(s) 174
AspLEI GCGC 1 cut(s) 189
BbsI GAAGAC 1 cut(s) 29
BbvI GCAGC 1 cut(s) 50
BccI CCATC 1 cut(s) 48
BfmI CTRYAG 1 cut(s) 36
BisI GCNGC 1 cut(s) 39
BlsI GCNGC 1 cut(s) 40
BmiI GGNNCC 1 cut(s) 154
BpiI GAAGAC 1 cut(s) 29
Bse1I ACTGG 1 cut(s) 164
BseMII CTCAG 1 cut(s) 71
BseNI ACTGG 1 cut(s) 164
BseXI GCAGC 1 cut(s) 50
BspACI CCGC 1 cut(s) 89
BspCNI CTCAG 1 cut(s) 72
BspLI GGNNCC 1 cut(s) 154
BspMAI CTGCAG 1 cut(s) 40
BsrI ACTGG 1 cut(s) 164
Bst4CI ACNGT 2 cut(s) 133, 226
Bst6I CTCTTC 2 cut(s) 11, 119
BstAPI GCANNNNNTGC 1 cut(s) 126
BstC8I GCNNGC 1 cut(s) 197
BstDEI CTNAG 1 cut(s) 80
BstHHI GCGC 1 cut(s) 189
BstMWI GCNNNNNNNGC 1 cut(s) 126
BstSFI CTRYAG 1 cut(s) 36
BstV1I GCAGC 1 cut(s) 50
BstV2I GAAGAC 1 cut(s) 29
BtsIMutI CAGTG 3 cut(s) 11, 129, 231
Cac8I GCNNGC 1 cut(s) 197
CfoI GCGC 1 cut(s) 189
CviJI RGCY 4 cut(s) 8, 41, 62, 230
CviKI_1 RGCY 4 cut(s) 8, 41, 62, 230
DdeI CTNAG 1 cut(s) 80
Eam1104I CTCTTC 2 cut(s) 11, 119
EarI CTCTTC 2 cut(s) 11, 119
Eco57I CTGAAG 1 cut(s) 35
FaiI YATR 3 cut(s) 87, 171, 181
FblI GTMKAC 1 cut(s) 76
Fnu4HI GCNGC 1 cut(s) 39
Fsp4HI GCNGC 1 cut(s) 39
GlaI GCGC 1 cut(s) 188
GluI GCNGC 1 cut(s) 39
HhaI GCGC 1 cut(s) 189
Hin6I GCGC 1 cut(s) 187
HinP1I GCGC 1 cut(s) 187
HindIII AAGCTT 1 cut(s) 6
HinfI GANTC 1 cut(s) 92
Hpy166II GTNNAC 1 cut(s) 77
Hpy8I GTNNAC 1 cut(s) 77
HpyCH4III ACNGT 2 cut(s) 133, 226
HpyCH4V TGCA 4 cut(s) 38, 105, 120, 129
HpyF10VI GCNNNNNNNGC 1 cut(s) 126
HpyF3I CTNAG 1 cut(s) 80
HspAI GCGC 1 cut(s) 187
LpnPI CCDG 2 cut(s) 64, 177
Lsp1109I GCAGC 1 cut(s) 50
MboII GAAGA 3 cut(s) 28, 34, 106
MluCI AATT 3 cut(s) 67, 174, 211
MnlI CCTC 3 cut(s) 12, 52, 185
MseI TTAA 1 cut(s) 71
MslI CAYNNNNRTG 1 cut(s) 100
MwoI GCNNNNNNNGC 1 cut(s) 126
NlaIV GGNNCC 1 cut(s) 154
PfeI GAWTC 1 cut(s) 92
PkrI GCNGC 1 cut(s) 40
PsiI TTATAA 1 cut(s) 171
PspN4I GGNNCC 1 cut(s) 154
PstI CTGCAG 1 cut(s) 40
RseI CAYNNNNRTG 1 cut(s) 100
SaqAI TTAA 1 cut(s) 71
SatI GCNGC 1 cut(s) 39
SetI ASST 1 cut(s) 10
SfcI CTRYAG 1 cut(s) 36
SgeI CNNG 4 cut(s) 63, 162, 176, 208
SmiMI CAYNNNNRTG 1 cut(s) 100
Sse9I AATT 3 cut(s) 67, 174, 211
SsiI CCGC 1 cut(s) 89
TaaI ACNGT 2 cut(s) 133, 226
TaqI TCGA 1 cut(s) 140
TasI AATT 3 cut(s) 67, 174, 211
TfiI GAWTC 1 cut(s) 92
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TscAI CASTG 3 cut(s) 18, 136, 231
TseI GCWGC 1 cut(s) 38
TspDTI ATGAA 1 cut(s) 158
TspRI CASTG 3 cut(s) 18, 136, 231
XapI RAATTY 1 cut(s) 174
XmiI GTMKAC 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.