Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr15

Orthogroup ID

OG0006900

Physical Location & Seq

Genomic Coordinates Forward (+)

45045470 .. 45048264

Gene Structure 2795 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD15G1370600.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 135 bp

ATGGGATCGGATGAAAGCAATGAAAACCATCCAGTTCTAGGAAACATAAAGCAAGCACTGGACACACTTGTCCGGCAAAGATATTTGCAGAAAGACAAAGTAAAGGAACCTGACGGCAATACTTTTTTTTTATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

MAGE

Protein Analysis

45

Amino Acids

5.05

Weight (kDa)

5.59

Isoelectric Point (pI)

33.12

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
MAGE	PF01454	4 - 40	2.2e-06	MAGE homology domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006900)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G34770 AT1G34770 AT1G34770 AT1G34770 AT1G34770 AT1G34770
fragaria_vesca	FvH4_5g37140
malus_domestica	MD08G1184100.v1.1 MD15G1370600.v1.1
prunus_persica	Prupe.1G518300_v2.0.a1
pyrus_communis	pycom08g15780 pycom15g33220 pycom15g33230
rosa_chinensis	RchiOBHm_Chr7g0238691 RchiOBHm_Chr7g0243981
rosa_laevigata	RLG00000000817
rosa_multiflora	Rmu_co8037164.1_g000001 Rmu_sc0006110.1_g000004 Rmu_sc0010914.1_g000013
rosa_roxburghii	Rroxscaffold_3G00221600
rosa_rugosa	Rorug07G0323100
rosa_samantha	Rh7AG477500 Rh7BG448800 Rh7CG495500 Rh7DG462400
rosa_wichuraiana	Rw7G039850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	68
AclWI	GGATC	1 cut(s)	13
AfiI	CCNNNNNNNGG	1 cut(s)	38
AlwI	GGATC	1 cut(s)	13
BccI	CCATC	1 cut(s)	36
BceAI	ACGGC	1 cut(s)	130
BfaI	CTAG	1 cut(s)	38
BmiI	GGNNCC	1 cut(s)	108
Bsc4I	CCNNNNNNNGG	1 cut(s)	38
Bse1I	ACTGG	2 cut(s)	32, 63
Bse3DI	GCAATG	1 cut(s)	25
BseGI	GGATG	2 cut(s)	16, 28
BseLI	CCNNNNNNNGG	1 cut(s)	38
BseMI	GCAATG	1 cut(s)	25
BseNI	ACTGG	2 cut(s)	32, 63
BsiSI	CCGG	1 cut(s)	73
BslI	CCNNNNNNNGG	1 cut(s)	38
Bsp143I	GATC	1 cut(s)	5
BspLI	GGNNCC	1 cut(s)	108
BspPI	GGATC	1 cut(s)	13
BsrDI	GCAATG	1 cut(s)	25
BsrI	ACTGG	2 cut(s)	32, 63
BssMI	GATC	1 cut(s)	5
BstC8I	GCNNGC	1 cut(s)	54
BstF5I	GGATG	2 cut(s)	16, 28
BstKTI	GATC	1 cut(s)	8
BstMBI	GATC	1 cut(s)	5
BtsCI	GGATG	2 cut(s)	16, 28
BtsIMutI	CAGTG	1 cut(s)	56
Cac8I	GCNNGC	1 cut(s)	54
DpnI	GATC	1 cut(s)	7
DpnII	GATC	1 cut(s)	5
DrdI	GACNNNNNNGTC	1 cut(s)	68
DseDI	GACNNNNNNGTC	1 cut(s)	68
FaiI	YATR	2 cut(s)	47, 133
FokI	GGATG	2 cut(s)	15, 23
FspBI	CTAG	1 cut(s)	38
FspEI	CC	9 cut(s)	24, 41, 44, 45, 58, 86, 89, 99, 123
HapII	CCGG	1 cut(s)	73
HpaII	CCGG	1 cut(s)	73
Hpy188I	TCNGA	1 cut(s)	10
HpyCH4V	TGCA	1 cut(s)	88
Kzo9I	GATC	1 cut(s)	5
LpnPI	CCDG	4 cut(s)	44, 45, 86, 123
MaeI	CTAG	1 cut(s)	38
MalI	GATC	1 cut(s)	7
MboI	GATC	1 cut(s)	5
MspI	CCGG	1 cut(s)	73
NdeII	GATC	1 cut(s)	5
NlaIV	GGNNCC	1 cut(s)	108
PspN4I	GGNNCC	1 cut(s)	108
Sau3AI	GATC	1 cut(s)	5
SetI	ASST	1 cut(s)	112
SgeI	CNNG	7 cut(s)	44, 50, 65, 71, 80, 85, 122
SspMI	CTAG	1 cut(s)	38
TscAI	CASTG	1 cut(s)	63
TspDTI	ATGAA	2 cut(s)	27, 36
TspRI	CASTG	1 cut(s)	63
XspI	CTAG	1 cut(s)	38

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.