Rmu_co8037164.1_g000001

Melanoma-associated antigen

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8037164.1
Physical Location & Seq
Forward (+)
1 .. 451
451 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8037164.1_g000001.1.cds

Sequence Viewer

Length: 269 bp
agaatctgtggcaacatttgaggcggataggactggatgaaactaacgaaagccatccagttctaggaaacacgaaacaagcactggaggcacttgtccagcaaaggtatttgcagaaggacaaacaaagtggacctgaaggcaatactttgttatatgagcttgctgagagagctttagattctcaagttactgcaaccatgaaagattacatatcgcaggtatcattagagatccagtttataatggttttattttttcaagtttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

10.15

Weight (kDa)

5.22

Isoelectric Point (pI)

39.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 244
Acc36I ACCTGC 1 cut(s) 210
AciI CCGC 1 cut(s) 24
AclWI GGATC 1 cut(s) 228
AcuI CTGAAG 1 cut(s) 158
AfiI CCNNNNNNNGG 1 cut(s) 64
AgsI TTSAA 1 cut(s) 262
AluBI AGCT 2 cut(s) 162, 175
AluI AGCT 2 cut(s) 162, 175
AlwI GGATC 1 cut(s) 228
AspS9I GGNCC 1 cut(s) 133
AvaII GGWCC 1 cut(s) 133
BccI CCATC 1 cut(s) 62
BfaI CTAG 1 cut(s) 64
BfuAI ACCTGC 1 cut(s) 210
Bme18I GGWCC 1 cut(s) 133
BmgT120I GGNCC 1 cut(s) 133
BpmI CTGGAG 1 cut(s) 106
BpuEI CTTGAG 1 cut(s) 170
Bsc4I CCNNNNNNNGG 1 cut(s) 64
Bse1I ACTGG 4 cut(s) 38, 58, 89, 237
BseGI GGATG 2 cut(s) 42, 54
BseLI CCNNNNNNNGG 1 cut(s) 64
BseMII CTCAG 1 cut(s) 158
BseNI ACTGG 4 cut(s) 38, 58, 89, 237
BslI CCNNNNNNNGG 1 cut(s) 64
Bsp143I GATC 1 cut(s) 233
BspACI CCGC 1 cut(s) 24
BspCNI CTCAG 1 cut(s) 159
BspMI ACCTGC 1 cut(s) 210
BspPI GGATC 1 cut(s) 228
BsrI ACTGG 4 cut(s) 38, 58, 89, 237
BssMI GATC 1 cut(s) 233
BstC8I GCNNGC 1 cut(s) 164
BstDEI CTNAG 1 cut(s) 167
BstF5I GGATG 2 cut(s) 42, 54
BstKTI GATC 1 cut(s) 236
BstMBI GATC 1 cut(s) 233
BstMWI GCNNNNNNNGC 2 cut(s) 88, 172
BstX2I RGATCY 1 cut(s) 233
BstYI RGATCY 1 cut(s) 233
BtsCI GGATG 2 cut(s) 42, 54
BtsIMutI CAGTG 1 cut(s) 82
BveI ACCTGC 1 cut(s) 210
Cac8I GCNNGC 1 cut(s) 164
Cfr13I GGNCC 1 cut(s) 133
CspCI CAANNNNNGTGG 2 cut(s) 111, 146
CviAII CATG 1 cut(s) 201
CviJI RGCY 3 cut(s) 53, 162, 175
CviKI_1 RGCY 3 cut(s) 53, 162, 175
DdeI CTNAG 1 cut(s) 167
DpnI GATC 1 cut(s) 235
DpnII GATC 1 cut(s) 233
EciI GGCGGA 1 cut(s) 39
Eco47I GGWCC 1 cut(s) 133
Eco57I CTGAAG 1 cut(s) 158
FaeI CATG 1 cut(s) 204
FaiI YATR 5 cut(s) 156, 158, 202, 214, 244
FatI CATG 1 cut(s) 200
FokI GGATG 2 cut(s) 41, 49
FspBI CTAG 1 cut(s) 64
GsuI CTGGAG 1 cut(s) 106
Hin1II CATG 1 cut(s) 204
HinfI GANTC 2 cut(s) 3, 181
Hpy166II GTNNAC 1 cut(s) 133
Hpy8I GTNNAC 1 cut(s) 133
HpyAV CCTTC 2 cut(s) 111, 133
HpyCH4V TGCA 2 cut(s) 114, 196
HpyF10VI GCNNNNNNNGC 2 cut(s) 88, 172
HpyF3I CTNAG 1 cut(s) 167
Hsp92II CATG 1 cut(s) 204
Kzo9I GATC 1 cut(s) 233
LpnPI CCDG 7 cut(s) 19, 70, 71, 112, 149, 205, 250
MaeI CTAG 1 cut(s) 64
MaeIII GTNAC 1 cut(s) 189
MalI GATC 1 cut(s) 235
MboI GATC 1 cut(s) 233
MflI RGATCY 1 cut(s) 233
MnlI CCTC 2 cut(s) 14, 81
MwoI GCNNNNNNNGC 2 cut(s) 88, 172
NdeII GATC 1 cut(s) 233
NlaIII CATG 1 cut(s) 204
PfeI GAWTC 2 cut(s) 3, 181
PsiI TTATAA 1 cut(s) 244
PspPI GGNCC 1 cut(s) 133
PsuI RGATCY 1 cut(s) 233
Sau3AI GATC 1 cut(s) 233
Sau96I GGNCC 1 cut(s) 133
SetI ASST 5 cut(s) 109, 138, 164, 177, 224
SinI GGWCC 1 cut(s) 133
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
SsiI CCGC 1 cut(s) 24
SspMI CTAG 1 cut(s) 64
TfiI GAWTC 2 cut(s) 3, 181
TscAI CASTG 1 cut(s) 89
TspDTI ATGAA 2 cut(s) 53, 217
TspRI CASTG 1 cut(s) 89
VpaK11BI GGWCC 1 cut(s) 133
XspI CTAG 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.