MD17G1210000.v1.1

EPIDERMAL PATTERNING FACTOR-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0006184
Physical Location & Seq
Forward (+)
25494443 .. 25495487
1045 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1210000.v1.1.491

Sequence Viewer

Length: 351 bp
ATGGCTCCTTCAACCAGAAACTACCGTGTACGTGGCCTCAAAGTTGCAATAATCACTGTGGCTTCCATCTTTTTACTCACGACTTTACTTCCCAAATCAGTGGATTCCGTGCAATCAAGCCATAACAATGAGAGTAGTGATGATCTGTTCTTGCAAAGCAAAATGGTGCTCGGTTCAAGGCCTCCAGGATGCCAGAACAAATGTTTGAATTGCAGGCCTTGCATTGCAACTCTGGTGATTCCGGTCCACAAAACAAAGCGTTTCAGTTTGTCATCTCATGGAGAAGAAAGTGATAGCTATTATTTGCTCTCCTGGAAATGCAGATGTGGAAATAAGCTATTTCAGCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EPF

Protein Analysis

117

Amino Acids

12.93

Weight (kDa)

9.47

Isoelectric Point (pI)

58.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EPF PF17181 56 - 116 2e-20 Epidermal patterning factor proteins
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 30
AgsI TTSAA 3 cut(s) 12, 177, 208
AjnI CCWGG 2 cut(s) 184, 311
AluBI AGCT 2 cut(s) 297, 337
AluI AGCT 2 cut(s) 297, 337
Alw21I GWGCWC 1 cut(s) 171
AoxI GGCC 3 cut(s) 34, 179, 215
AspS9I GGNCC 1 cut(s) 244
AsuHPI GGTGA 1 cut(s) 247
AvaII GGWCC 1 cut(s) 244
Bbv12I GWGCWC 1 cut(s) 171
BccI CCATC 1 cut(s) 74
BciT130I CCWGG 2 cut(s) 186, 313
Bme1390I CCNGG 2 cut(s) 186, 313
Bme18I GGWCC 1 cut(s) 244
BmgT120I GGNCC 1 cut(s) 244
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 2 cut(s) 186, 313
BmsI GCATC 1 cut(s) 179
BpmI CTGGAG 1 cut(s) 168
BsaAI YACGTR 1 cut(s) 32
BsaWI WCCGGW 1 cut(s) 241
Bse3DI GCAATG 1 cut(s) 222
BseBI CCWGG 2 cut(s) 186, 313
BseGI GGATG 1 cut(s) 194
BseMI GCAATG 1 cut(s) 222
BshFI GGCC 3 cut(s) 36, 181, 217
BsiHKAI GWGCWC 1 cut(s) 171
BsiSI CCGG 1 cut(s) 242
BsnI GGCC 3 cut(s) 36, 181, 217
Bsp1286I GDGCHC 1 cut(s) 171
Bsp143I GATC 1 cut(s) 142
BspANI GGCC 3 cut(s) 36, 181, 217
BspLI GGNNCC 1 cut(s) 6
BsrDI GCAATG 1 cut(s) 222
BssMI GATC 1 cut(s) 142
Bst2UI CCWGG 2 cut(s) 186, 313
Bst4CI ACNGT 2 cut(s) 26, 58
BstAPI GCANNNNNTGC 1 cut(s) 219
BstBAI YACGTR 1 cut(s) 32
BstC8I GCNNGC 1 cut(s) 215
BstF5I GGATG 1 cut(s) 194
BstKTI GATC 1 cut(s) 145
BstMBI GATC 1 cut(s) 142
BstMWI GCNNNNNNNGC 2 cut(s) 219, 343
BstNI CCWGG 2 cut(s) 186, 313
BstSCI CCNGG 2 cut(s) 184, 311
BstXI CCANNNNNNTGG 1 cut(s) 100
BsuRI GGCC 3 cut(s) 36, 181, 217
BtsCI GGATG 1 cut(s) 194
BtsIMutI CAGTG 2 cut(s) 54, 105
Cac8I GCNNGC 1 cut(s) 215
Cfr13I GGNCC 1 cut(s) 244
Csp6I GTAC 1 cut(s) 29
CviAII CATG 2 cut(s) 278, 348
CviJI RGCY 9 cut(s) 5, 36, 62, 120, 181, 217, 297, 337, 346
CviKI_1 RGCY 9 cut(s) 5, 36, 62, 120, 181, 217, 297, 337, 346
CviQI GTAC 1 cut(s) 29
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
Eco147I AGGCCT 2 cut(s) 181, 217
Eco47I GGWCC 1 cut(s) 244
EcoRII CCWGG 2 cut(s) 184, 311
FaeI CATG 2 cut(s) 281, 351
FaiI YATR 3 cut(s) 123, 279, 349
FatI CATG 2 cut(s) 277, 347
FokI GGATG 1 cut(s) 201
GsuI CTGGAG 1 cut(s) 168
HaeIII GGCC 3 cut(s) 36, 181, 217
HapII CCGG 1 cut(s) 242
Hin1II CATG 2 cut(s) 281, 351
HinfI GANTC 2 cut(s) 104, 238
HpaII CCGG 1 cut(s) 242
HphI GGTGA 1 cut(s) 247
Hpy166II GTNNAC 2 cut(s) 29, 247
Hpy188III TCNNGA 1 cut(s) 79
Hpy8I GTNNAC 2 cut(s) 29, 247
HpyAV CCTTC 1 cut(s) 18
HpyCH4III ACNGT 2 cut(s) 26, 58
HpyCH4IV ACGT 1 cut(s) 31
HpyCH4V TGCA 7 cut(s) 47, 112, 154, 213, 222, 227, 321
HpyF10VI GCNNNNNNNGC 2 cut(s) 219, 343
HpySE526I ACGT 1 cut(s) 31
Hsp92II CATG 2 cut(s) 281, 351
Kzo9I GATC 1 cut(s) 142
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 9 cut(s) 28, 171, 198, 199, 206, 218, 255, 298, 325
LweI GCATC 1 cut(s) 179
MaeII ACGT 1 cut(s) 31
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 1 cut(s) 296
MhlI GDGCHC 1 cut(s) 171
MluCI AATT 1 cut(s) 208
MnlI CCTC 2 cut(s) 47, 192
MslI CAYNNNNRTG 1 cut(s) 126
MspI CCGG 1 cut(s) 242
MspR9I CCNGG 2 cut(s) 186, 313
MvaI CCWGG 2 cut(s) 186, 313
MwoI GCNNNNNNNGC 2 cut(s) 219, 343
NdeII GATC 1 cut(s) 142
NlaIII CATG 2 cut(s) 281, 351
NlaIV GGNNCC 1 cut(s) 6
PceI AGGCCT 2 cut(s) 181, 217
PfeI GAWTC 2 cut(s) 104, 238
PfoI TCCNGGA 2 cut(s) 184, 311
Ppu21I YACGTR 1 cut(s) 32
Psp6I CCWGG 2 cut(s) 184, 311
PspGI CCWGG 2 cut(s) 184, 311
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 244
RsaI GTAC 1 cut(s) 30
RsaNI GTAC 1 cut(s) 29
RseI CAYNNNNRTG 1 cut(s) 126
Sau3AI GATC 1 cut(s) 142
Sau96I GGNCC 1 cut(s) 244
ScrFI CCNGG 2 cut(s) 186, 313
SduI GDGCHC 1 cut(s) 171
SetI ASST 3 cut(s) 34, 299, 339
SfaNI GCATC 1 cut(s) 179
SinI GGWCC 1 cut(s) 244
SmiMI CAYNNNNRTG 1 cut(s) 126
Sse9I AATT 1 cut(s) 208
SseBI AGGCCT 2 cut(s) 181, 217
StuI AGGCCT 2 cut(s) 181, 217
StyD4I CCNGG 2 cut(s) 184, 311
TaaI ACNGT 2 cut(s) 26, 58
TaiI ACGT 1 cut(s) 34
TasI AATT 1 cut(s) 208
TfiI GAWTC 2 cut(s) 104, 238
TscAI CASTG 2 cut(s) 61, 105
TspGWI ACGGA 1 cut(s) 97
TspRI CASTG 2 cut(s) 61, 105
VpaK11BI GGWCC 1 cut(s) 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.