MD17G1259600.v1.1

valine--tRNA ligase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0004429
Physical Location & Seq
Reverse (-)
32039823 .. 32040721
899 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1259600.v1.1.491

Sequence Viewer

Length: 162 bp
ATGCCATTGGTGACCGGGGAAATCTGGCAGACTAGAGCTATCAGAAATGCTCGAGCAGAATATTCTGTTGAGCCTGTAAAGCGTATATCAGCATCTATAGTTGCAAATGAAGAAGTCACTGAATACATATGGGGAATGTGGATCAATCAGTCCATCTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00970 map00970
Pfam Domains
Protein Families
Anticodon_1 Val_tRNA-synt_C tRNA-synt_1

Protein Analysis

54

Amino Acids

6.12

Weight (kDa)

5.15

Isoelectric Point (pI)

47.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 149
AluBI AGCT 1 cut(s) 38
AluI AGCT 1 cut(s) 38
AlwI GGATC 1 cut(s) 149
Ama87I CYCGRG 1 cut(s) 51
AsuC2I CCSGG 1 cut(s) 16
AsuHPI GGTGA 1 cut(s) 22
AvaI CYCGRG 1 cut(s) 51
BccI CCATC 1 cut(s) 161
BcnI CCSGG 1 cut(s) 16
BfaI CTAG 1 cut(s) 33
BfmI CTRYAG 1 cut(s) 96
Bme1390I CCNGG 1 cut(s) 16
BmeT110I CYCGRG 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 16
BmsI GCATC 1 cut(s) 101
BpuMI CCSGG 1 cut(s) 16
BsaJI CCNNGG 1 cut(s) 15
BseDI CCNNGG 1 cut(s) 15
BsiHKCI CYCGRG 1 cut(s) 51
BsiSI CCGG 1 cut(s) 15
BsoBI CYCGRG 1 cut(s) 51
Bsp143I GATC 1 cut(s) 141
BspPI GGATC 1 cut(s) 149
BssECI CCNNGG 1 cut(s) 15
BssMI GATC 1 cut(s) 141
BstEII GGTNACC 1 cut(s) 10
BstKTI GATC 1 cut(s) 144
BstMBI GATC 1 cut(s) 141
BstMWI GCNNNNNNNGC 1 cut(s) 79
BstPI GGTNACC 1 cut(s) 10
BstSCI CCNGG 1 cut(s) 14
BstSFI CTRYAG 1 cut(s) 96
BtsIMutI CAGTG 1 cut(s) 117
CviJI RGCY 2 cut(s) 38, 73
CviKI_1 RGCY 2 cut(s) 38, 73
DpnI GATC 1 cut(s) 143
DpnII GATC 1 cut(s) 141
Eco88I CYCGRG 1 cut(s) 51
Eco91I GGTNACC 1 cut(s) 10
EcoO65I GGTNACC 1 cut(s) 10
FaiI YATR 4 cut(s) 86, 98, 128, 130
FauNDI CATATG 1 cut(s) 128
FspBI CTAG 1 cut(s) 33
FspEI CC 9 cut(s) 2, 10, 18, 28, 87, 115, 116, 117, 124
HapII CCGG 1 cut(s) 15
HpaII CCGG 1 cut(s) 15
HphI GGTGA 1 cut(s) 22
Hpy188I TCNGA 1 cut(s) 44
HpyCH4V TGCA 1 cut(s) 104
HpyF10VI GCNNNNNNNGC 1 cut(s) 79
Kzo9I GATC 1 cut(s) 141
LpnPI CCDG 3 cut(s) 10, 28, 87
LweI GCATC 1 cut(s) 101
MaeI CTAG 1 cut(s) 33
MaeIII GTNAC 2 cut(s) 10, 115
MalI GATC 1 cut(s) 143
MboI GATC 1 cut(s) 141
MboII GAAGA 1 cut(s) 122
MspI CCGG 1 cut(s) 15
MspR9I CCNGG 1 cut(s) 16
MwoI GCNNNNNNNGC 1 cut(s) 79
NciI CCSGG 1 cut(s) 16
NdeI CATATG 1 cut(s) 128
NdeII GATC 1 cut(s) 141
NmuCI GTSAC 2 cut(s) 10, 115
PaeR7I CTCGAG 1 cut(s) 51
PspEI GGTNACC 1 cut(s) 10
PspXI VCTCGAGB 1 cut(s) 51
Sau3AI GATC 1 cut(s) 141
ScrFI CCNGG 1 cut(s) 16
SetI ASST 1 cut(s) 40
SfaNI GCATC 1 cut(s) 101
SfcI CTRYAG 1 cut(s) 96
Sfr274I CTCGAG 1 cut(s) 51
SgeI CNNG 7 cut(s) 27, 28, 37, 45, 63, 65, 86
SlaI CTCGAG 1 cut(s) 51
SmlI CTYRAG 1 cut(s) 51
SmoI CTYRAG 1 cut(s) 51
SspI AATATT 1 cut(s) 62
SspMI CTAG 1 cut(s) 33
StyD4I CCNGG 1 cut(s) 14
TaqI TCGA 1 cut(s) 52
TscAI CASTG 1 cut(s) 124
TseFI GTSAC 2 cut(s) 10, 115
Tsp45I GTSAC 2 cut(s) 10, 115
TspDTI ATGAA 1 cut(s) 123
TspRI CASTG 1 cut(s) 124
XhoI CTCGAG 1 cut(s) 51
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.