Prupe.1G325400_v2.0.a1

plant mutator transposase zinc finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0009659
Physical Location & Seq
Forward (+)
31022478 .. 31024935
2458 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G325400.2

Sequence Viewer

Length: 174 bp
ATGCCAGGGATGGACGGGTCGATAGTTGGTAGATGCCGGTTTGGGTTGAAAACTTATTCAGTATTGATTTTCAAGGATACCAAGTACGTGGACTTATGCAGCCAAATTTGCTCTCAATTTAAAGAGTTGAATTCATGTGAAATGGAGATGACATACGCAATTGGAAACCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

58

Amino Acids

6.46

Weight (kDa)

6.52

Isoelectric Point (pI)

15.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 105, 130
AfaI GTAC 1 cut(s) 86
AgsI TTSAA 3 cut(s) 49, 73, 130
AjnI CCWGG 1 cut(s) 4
ApeKI GCWGC 1 cut(s) 99
ApoI RAATTY 2 cut(s) 105, 130
BbvI GCAGC 1 cut(s) 111
BccI CCATC 1 cut(s) 4
BciT130I CCWGG 1 cut(s) 6
BciVI GTATCC 1 cut(s) 70
BfuI GTATCC 1 cut(s) 70
BisI GCNGC 1 cut(s) 100
BlsI GCNGC 1 cut(s) 101
Bme1390I CCNGG 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 6
BmsI GCATC 1 cut(s) 23
BsaAI YACGTR 1 cut(s) 88
BsaJI CCNNGG 1 cut(s) 5
Bse118I RCCGGY 1 cut(s) 36
BseBI CCWGG 1 cut(s) 6
BseDI CCNNGG 1 cut(s) 5
BseGI GGATG 1 cut(s) 15
BseXI GCAGC 1 cut(s) 111
BsiSI CCGG 1 cut(s) 37
BsrFI RCCGGY 1 cut(s) 36
BssAI RCCGGY 1 cut(s) 36
BssECI CCNNGG 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 6
BstBAI YACGTR 1 cut(s) 88
BstF5I GGATG 1 cut(s) 15
BstMWI GCNNNNNNNGC 1 cut(s) 108
BstNI CCWGG 1 cut(s) 6
BstSCI CCNGG 1 cut(s) 4
BstV1I GCAGC 1 cut(s) 111
BstXI CCANNNNNNTGG 1 cut(s) 88
BsuI GTATCC 1 cut(s) 70
BtsCI GGATG 1 cut(s) 15
Cfr10I RCCGGY 1 cut(s) 36
Csp6I GTAC 1 cut(s) 85
CviAII CATG 1 cut(s) 135
CviJI RGCY 1 cut(s) 102
CviKI_1 RGCY 1 cut(s) 102
CviQI GTAC 1 cut(s) 85
DraI TTTAAA 1 cut(s) 121
EcoRI GAATTC 1 cut(s) 130
EcoRII CCWGG 1 cut(s) 4
FaeI CATG 1 cut(s) 138
FaiI YATR 3 cut(s) 97, 136, 154
FatI CATG 1 cut(s) 134
Fnu4HI GCNGC 1 cut(s) 100
FokI GGATG 1 cut(s) 22
Fsp4HI GCNGC 1 cut(s) 100
GluI GCNGC 1 cut(s) 100
HapII CCGG 1 cut(s) 37
Hin1II CATG 1 cut(s) 138
HpaII CCGG 1 cut(s) 37
Hpy166II GTNNAC 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 91
HpyCH4IV ACGT 1 cut(s) 87
HpyCH4V TGCA 1 cut(s) 99
HpyF10VI GCNNNNNNNGC 1 cut(s) 108
HpySE526I ACGT 1 cut(s) 87
Hsp92II CATG 1 cut(s) 138
LpnPI CCDG 2 cut(s) 18, 50
Lsp1109I GCAGC 1 cut(s) 111
LweI GCATC 1 cut(s) 23
MaeII ACGT 1 cut(s) 87
MfeI CAATTG 1 cut(s) 159
MluCI AATT 4 cut(s) 105, 116, 130, 159
MseI TTAA 1 cut(s) 120
MspI CCGG 1 cut(s) 37
MspR9I CCNGG 1 cut(s) 6
MunI CAATTG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 6
MwoI GCNNNNNNNGC 1 cut(s) 108
NlaIII CATG 1 cut(s) 138
PkrI GCNGC 1 cut(s) 101
Ppu21I YACGTR 1 cut(s) 88
Psp6I CCWGG 1 cut(s) 4
PspGI CCWGG 1 cut(s) 4
RsaI GTAC 1 cut(s) 86
RsaNI GTAC 1 cut(s) 85
SaqAI TTAA 1 cut(s) 120
SatI GCNGC 1 cut(s) 100
ScrFI CCNGG 1 cut(s) 6
SetI ASST 1 cut(s) 90
SfaNI GCATC 1 cut(s) 23
SgeI CNNG 8 cut(s) 17, 18, 28, 49, 85, 94, 100, 147
Sse9I AATT 4 cut(s) 105, 116, 130, 159
StyD4I CCNGG 1 cut(s) 4
TaiI ACGT 1 cut(s) 90
TaqI TCGA 1 cut(s) 20
TasI AATT 4 cut(s) 105, 116, 130, 159
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TseI GCWGC 1 cut(s) 99
TspDTI ATGAA 1 cut(s) 123
XapI RAATTY 2 cut(s) 105, 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.