Rroxscaffold_7G00179610

plant mutator transposase zinc finger

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
19112425 .. 19115364
2940 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00179610.1

Sequence Viewer

Length: 192 bp
ATGGTCTTCATTGATGGTACGACAAGGTTCGCCGATTTTTTCAATGAAATTTGCATGCGGTTTAAGGGTTTGAAGCCGTGCTTGTTTGAGTTGAAGTATTCCCTTCCGGATTACCCTTCTTGTGCTCTCGATTCTGATTTAGATACGAGATACAACAGGATTATGACTATTGATCGTACCGATGTTCGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.47

Weight (kDa)

5.12

Isoelectric Point (pI)

17.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 106
AciI CCGC 1 cut(s) 58
AcsI RAATTY 1 cut(s) 48
AfaI GTAC 2 cut(s) 19, 178
AfiI CCNNNNNNNGG 1 cut(s) 186
AgsI TTSAA 3 cut(s) 43, 73, 94
Alw21I GWGCWC 1 cut(s) 127
Aor13HI TCCGGA 1 cut(s) 106
ApoI RAATTY 1 cut(s) 48
Bbv12I GWGCWC 1 cut(s) 127
BccI CCATC 1 cut(s) 8
BceAI ACGGC 1 cut(s) 61
BsaWI WCCGGW 1 cut(s) 106
Bsc4I CCNNNNNNNGG 1 cut(s) 186
BseAI TCCGGA 1 cut(s) 106
BseLI CCNNNNNNNGG 1 cut(s) 186
BsiHKAI GWGCWC 1 cut(s) 127
BsiSI CCGG 1 cut(s) 107
BslI CCNNNNNNNGG 1 cut(s) 186
Bsp1286I GDGCHC 1 cut(s) 127
Bsp13I TCCGGA 1 cut(s) 106
Bsp143I GATC 1 cut(s) 172
BspACI CCGC 1 cut(s) 58
BspEI TCCGGA 1 cut(s) 106
BssMI GATC 1 cut(s) 172
BstC8I GCNNGC 1 cut(s) 56
BstKTI GATC 1 cut(s) 175
BstMBI GATC 1 cut(s) 172
BstNSI RCATGY 1 cut(s) 58
Cac8I GCNNGC 1 cut(s) 56
Csp6I GTAC 2 cut(s) 18, 177
CviAII CATG 1 cut(s) 55
CviJI RGCY 1 cut(s) 76
CviKI_1 RGCY 1 cut(s) 76
CviQI GTAC 2 cut(s) 18, 177
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
FaeI CATG 1 cut(s) 58
FaiI YATR 2 cut(s) 56, 164
FalI AAGNNNNNCTT 2 cut(s) 65, 97
FatI CATG 1 cut(s) 54
HapII CCGG 1 cut(s) 107
Hin1II CATG 1 cut(s) 58
HinfI GANTC 1 cut(s) 131
HpaII CCGG 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 136
Hpy188III TCNNGA 2 cut(s) 107, 128
HpyAV CCTTC 2 cut(s) 113, 126
HpyCH4V TGCA 1 cut(s) 54
Hsp92II CATG 1 cut(s) 58
Kpn2I TCCGGA 1 cut(s) 106
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 2 cut(s) 120, 142
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MhlI GDGCHC 1 cut(s) 127
MluCI AATT 1 cut(s) 48
MroI TCCGGA 1 cut(s) 106
MseI TTAA 1 cut(s) 63
MspI CCGG 1 cut(s) 107
NdeII GATC 1 cut(s) 172
NlaIII CATG 1 cut(s) 58
NspI RCATGY 1 cut(s) 58
PaeI GCATGC 1 cut(s) 58
PfeI GAWTC 1 cut(s) 131
RsaI GTAC 2 cut(s) 19, 178
RsaNI GTAC 2 cut(s) 18, 177
SaqAI TTAA 1 cut(s) 63
Sau3AI GATC 1 cut(s) 172
SduI GDGCHC 1 cut(s) 127
SetI ASST 1 cut(s) 29
SgeI CNNG 9 cut(s) 36, 67, 90, 94, 119, 132, 140, 159, 169
SphI GCATGC 1 cut(s) 58
Sse9I AATT 1 cut(s) 48
SsiI CCGC 1 cut(s) 58
TaqI TCGA 1 cut(s) 129
TasI AATT 1 cut(s) 48
TfiI GAWTC 1 cut(s) 131
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TspDTI ATGAA 1 cut(s) 60
XapI RAATTY 1 cut(s) 48
XceI RCATGY 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.