Rh1CG100700

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0009659
Physical Location & Seq
Forward (+)
21050384 .. 21050987
604 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG100700.1

Sequence Viewer

Length: 252 bp
ATGGAGAATTTGAATCCAAACACAAGCTCAGCTGTTCTTACTTTTTGGAGTGGATTTGTGCTAGGAACCATGTATTTGGAGGTGGTTGCTAGGTGTGCTTACATGTTAGAGACTGTGATGGTCTTCATTGATGGTACAACAATTTGCATGCGGTTTAAGGATTTGAAGCCAGGCTTGTTTGAGTTGAAGTATTCCCTTCCGAATTACCTTTCTTGTGCTCTTGATTCTGATTTAGATATGAGGTTGATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

83

Amino Acids

9.45

Weight (kDa)

4.56

Isoelectric Point (pI)

24.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 151
AcsI RAATTY 1 cut(s) 7
AfaI GTAC 1 cut(s) 136
AflIII ACRYGT 1 cut(s) 102
AgsI TTSAA 3 cut(s) 13, 166, 187
AjnI CCWGG 1 cut(s) 169
AluBI AGCT 2 cut(s) 27, 32
AluI AGCT 2 cut(s) 27, 32
Alw21I GWGCWC 1 cut(s) 220
Alw26I GTCTC 1 cut(s) 104
ApoI RAATTY 1 cut(s) 7
BbsI GAAGAC 1 cut(s) 115
Bbv12I GWGCWC 1 cut(s) 220
BccI CCATC 2 cut(s) 112, 125
BciT130I CCWGG 1 cut(s) 171
BcoDI GTCTC 1 cut(s) 104
BfaI CTAG 2 cut(s) 62, 90
BlpI GCTNAGC 1 cut(s) 28
Bme1390I CCNGG 1 cut(s) 171
BmiI GGNNCC 1 cut(s) 67
BmrFI CCNGG 1 cut(s) 171
BpiI GAAGAC 1 cut(s) 115
Bpu1102I GCTNAGC 1 cut(s) 28
BseBI CCWGG 1 cut(s) 171
BseMII CTCAG 1 cut(s) 42
BsiHKAI GWGCWC 1 cut(s) 220
BsmAI GTCTC 1 cut(s) 104
Bsp1286I GDGCHC 1 cut(s) 220
Bsp1720I GCTNAGC 1 cut(s) 28
BspACI CCGC 1 cut(s) 151
BspCNI CTCAG 1 cut(s) 41
BspLI GGNNCC 1 cut(s) 67
Bst2UI CCWGG 1 cut(s) 171
Bst4CI ACNGT 1 cut(s) 115
BstC8I GCNNGC 1 cut(s) 149
BstDEI CTNAG 1 cut(s) 28
BstMAI GTCTC 1 cut(s) 104
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstNI CCWGG 1 cut(s) 171
BstNSI RCATGY 2 cut(s) 106, 151
BstSCI CCNGG 1 cut(s) 169
BstV2I GAAGAC 1 cut(s) 115
BstXI CCANNNNNNTGG 1 cut(s) 76
Cac8I GCNNGC 1 cut(s) 149
Csp6I GTAC 1 cut(s) 135
CviAII CATG 3 cut(s) 70, 103, 148
CviJI RGCY 4 cut(s) 27, 32, 169, 174
CviKI_1 RGCY 4 cut(s) 27, 32, 169, 174
CviQI GTAC 1 cut(s) 135
DdeI CTNAG 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 169
FaeI CATG 3 cut(s) 73, 106, 151
FaiI YATR 4 cut(s) 71, 104, 149, 239
FalI AAGNNNNNCTT 2 cut(s) 158, 190
FatI CATG 3 cut(s) 69, 102, 147
FspBI CTAG 2 cut(s) 62, 90
Hin1II CATG 3 cut(s) 73, 106, 151
HinfI GANTC 2 cut(s) 13, 224
Hpy188I TCNGA 2 cut(s) 201, 229
Hpy188III TCNNGA 1 cut(s) 221
HpyAV CCTTC 1 cut(s) 206
HpyCH4III ACNGT 1 cut(s) 115
HpyCH4V TGCA 1 cut(s) 147
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 28
Hsp92II CATG 3 cut(s) 73, 106, 151
LpnPI CCDG 2 cut(s) 156, 183
MaeI CTAG 2 cut(s) 62, 90
MboII GAAGA 1 cut(s) 115
MhlI GDGCHC 1 cut(s) 220
MluCI AATT 3 cut(s) 7, 141, 202
MnlI CCTC 2 cut(s) 73, 234
MseI TTAA 1 cut(s) 156
MspA1I CMGCKG 1 cut(s) 32
MspR9I CCNGG 1 cut(s) 171
MvaI CCWGG 1 cut(s) 171
MwoI GCNNNNNNNGC 1 cut(s) 95
NlaIII CATG 3 cut(s) 73, 106, 151
NlaIV GGNNCC 1 cut(s) 67
NspI RCATGY 2 cut(s) 106, 151
PaeI GCATGC 1 cut(s) 151
PciI ACATGT 1 cut(s) 102
PfeI GAWTC 2 cut(s) 13, 224
PscI ACATGT 1 cut(s) 102
Psp6I CCWGG 1 cut(s) 169
PspGI CCWGG 1 cut(s) 169
PspN4I GGNNCC 1 cut(s) 67
PvuII CAGCTG 1 cut(s) 32
RsaI GTAC 1 cut(s) 136
RsaNI GTAC 1 cut(s) 135
SaqAI TTAA 1 cut(s) 156
ScrFI CCNGG 1 cut(s) 171
SduI GDGCHC 1 cut(s) 220
SetI ASST 6 cut(s) 29, 34, 84, 95, 210, 245
SphI GCATGC 1 cut(s) 151
Sse9I AATT 3 cut(s) 7, 141, 202
SsiI CCGC 1 cut(s) 151
SspMI CTAG 2 cut(s) 62, 90
StyD4I CCNGG 1 cut(s) 169
TaaI ACNGT 1 cut(s) 115
TasI AATT 3 cut(s) 7, 141, 202
TfiI GAWTC 2 cut(s) 13, 224
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TspDTI ATGAA 1 cut(s) 115
XapI RAATTY 1 cut(s) 7
XceI RCATGY 2 cut(s) 106, 151
XspI CTAG 2 cut(s) 62, 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.