Rh2AG197600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0009659
Physical Location & Seq
Forward (+)
19873438 .. 19874198
761 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG197600.1

Sequence Viewer

Length: 183 bp
ATGGAGTGCAAGCGTTTCGAAACGGAGGTGAATCGGATCAAGGACTTGACGGGCAACCAAGTAAAGACATTCACTATGATCTCTTCTGACCACAAGGCTATCGTGATTTTCAAAACTGGTTCAACCTCTGCGTCATTGAAGCCGCAAGAGCACATCGGAGCTCTGATTCTAGTGGAGGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.69

Weight (kDa)

7.93

Isoelectric Point (pI)

34.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 143
AclWI GGATC 1 cut(s) 44
AgsI TTSAA 3 cut(s) 112, 123, 139
AluBI AGCT 1 cut(s) 161
AluI AGCT 1 cut(s) 161
Alw21I GWGCWC 2 cut(s) 153, 163
AlwI GGATC 1 cut(s) 44
AsuHPI GGTGA 1 cut(s) 40
AsuII TTCGAA 1 cut(s) 18
BanII GRGCYC 1 cut(s) 163
Bbv12I GWGCWC 2 cut(s) 153, 163
BcgI CGANNNNNNTGC 1 cut(s) 32
BfaI CTAG 1 cut(s) 170
BisI GCNGC 1 cut(s) 143
BlsI GCNGC 1 cut(s) 144
Bpu14I TTCGAA 1 cut(s) 18
Bse1I ACTGG 1 cut(s) 121
BseNI ACTGG 1 cut(s) 121
BsiHKAI GWGCWC 2 cut(s) 153, 163
Bsp119I TTCGAA 1 cut(s) 18
Bsp1286I GDGCHC 2 cut(s) 153, 163
Bsp143I GATC 2 cut(s) 36, 78
BspACI CCGC 1 cut(s) 143
BspPI GGATC 1 cut(s) 44
BspT104I TTCGAA 1 cut(s) 18
BsrI ACTGG 1 cut(s) 121
BssMI GATC 2 cut(s) 36, 78
Bst6I CTCTTC 1 cut(s) 88
BstBI TTCGAA 1 cut(s) 18
BstC8I GCNNGC 1 cut(s) 11
BstKTI GATC 2 cut(s) 39, 81
BstMBI GATC 2 cut(s) 36, 78
BstMWI GCNNNNNNNGC 1 cut(s) 148
Cac8I GCNNGC 1 cut(s) 11
CseI GACGC 1 cut(s) 120
CviJI RGCY 3 cut(s) 98, 142, 161
CviKI_1 RGCY 3 cut(s) 98, 142, 161
DpnI GATC 2 cut(s) 38, 80
DpnII GATC 2 cut(s) 36, 78
Eam1104I CTCTTC 1 cut(s) 88
EarI CTCTTC 1 cut(s) 88
Ecl136II GAGCTC 1 cut(s) 161
Eco24I GRGCYC 1 cut(s) 163
Eco53kI GAGCTC 1 cut(s) 161
EcoICRI GAGCTC 1 cut(s) 161
EcoT38I GRGCYC 1 cut(s) 163
FaiI YATR 1 cut(s) 77
Fnu4HI GCNGC 1 cut(s) 143
FriOI GRGCYC 1 cut(s) 163
Fsp4HI GCNGC 1 cut(s) 143
FspBI CTAG 1 cut(s) 170
GluI GCNGC 1 cut(s) 143
HgaI GACGC 1 cut(s) 120
HinfI GANTC 2 cut(s) 31, 166
HphI GGTGA 1 cut(s) 40
Hpy188I TCNGA 5 cut(s) 36, 88, 158, 165, 182
Hpy188III TCNNGA 1 cut(s) 103
HpyCH4V TGCA 1 cut(s) 9
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
Kzo9I GATC 2 cut(s) 36, 78
LmnI GCTCC 1 cut(s) 158
LpnPI CCDG 1 cut(s) 102
MaeI CTAG 1 cut(s) 170
MalI GATC 2 cut(s) 38, 80
MboI GATC 2 cut(s) 36, 78
MboII GAAGA 1 cut(s) 75
MhlI GDGCHC 2 cut(s) 153, 163
MnlI CCTC 3 cut(s) 19, 136, 169
MwoI GCNNNNNNNGC 1 cut(s) 148
NdeII GATC 2 cut(s) 36, 78
NspV TTCGAA 1 cut(s) 18
PfeI GAWTC 2 cut(s) 31, 166
PkrI GCNGC 1 cut(s) 144
Psp124BI GAGCTC 1 cut(s) 163
SacI GAGCTC 1 cut(s) 163
SatI GCNGC 1 cut(s) 143
Sau3AI GATC 2 cut(s) 36, 78
SduI GDGCHC 2 cut(s) 153, 163
SetI ASST 4 cut(s) 30, 128, 163, 180
SfuI TTCGAA 1 cut(s) 18
SgeI CNNG 9 cut(s) 22, 52, 58, 63, 71, 106, 115, 129, 158
SsiI CCGC 1 cut(s) 143
SspMI CTAG 1 cut(s) 170
SstI GAGCTC 1 cut(s) 163
TaqI TCGA 1 cut(s) 18
TauI GCSGC 1 cut(s) 145
TfiI GAWTC 2 cut(s) 31, 166
TspGWI ACGGA 1 cut(s) 38
XspI CTAG 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.