Prupe.2G003000_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
341133 .. 343084
1952 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G003000.1

Sequence Viewer

Length: 390 bp
ATGAAAATGGCATCCGTCTTGGCTGCAGCACAAGCACGACTTTCATCCCAGCTGCTTCGTCCAATACCTCAGAATCAGATTCCCATCACTCACTCCCTCAAACGCAGCGCCGTTAAAGCAGCGCCTTTCGATTTCAGCTTGGAGAGGAATGTTTTGAGATTGAAAATAAGGGAAAGCTGGCACGCTGTGTCTGCATCAAACTCTAACCCTTCAAGTGGAGATTCCGTTGAAGATAAATCAGGTGGGGTTAAAACCAATGATGCTGCACAAGGCCCTCCTTTGCTTACCATTGTGGCTGGATTTGTCGTCTTTTTTCTCTTATTTTGGATTTTGGGGTCAACTCTAATGTGGTTGATTGGTCTAGTTGTTAGATTTCCTCCACCTAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

130

Amino Acids

14.02

Weight (kDa)

10.64

Isoelectric Point (pI)

45.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014783)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 187
AfiI CCNNNNNNNGG 1 cut(s) 215
AgsI TTSAA 3 cut(s) 163, 213, 230
AluBI AGCT 3 cut(s) 52, 138, 177
AluI AGCT 3 cut(s) 52, 138, 177
AoxI GGCC 1 cut(s) 271
ApeKI GCWGC 6 cut(s) 23, 26, 52, 105, 119, 263
AspLEI GCGC 2 cut(s) 110, 124
AspS9I GGNCC 1 cut(s) 272
BbvI GCAGC 6 cut(s) 10, 38, 39, 117, 131, 250
BccI CCATC 1 cut(s) 92
BceAI ACGGC 1 cut(s) 95
BfaI CTAG 1 cut(s) 362
BfmI CTRYAG 1 cut(s) 24
BfoI RGCGCY 2 cut(s) 111, 125
BisI GCNGC 6 cut(s) 24, 27, 53, 106, 120, 264
BlsI GCNGC 6 cut(s) 25, 28, 54, 107, 121, 265
BmgT120I GGNCC 1 cut(s) 272
BmsI GCATC 3 cut(s) 20, 203, 250
BsaBI GATNNNNATC 1 cut(s) 83
BsaXI ACNNNNNCTCC 2 cut(s) 210, 240
Bsc4I CCNNNNNNNGG 1 cut(s) 215
Bse8I GATNNNNATC 1 cut(s) 83
BseGI GGATG 2 cut(s) 11, 44
BseJI GATNNNNATC 1 cut(s) 83
BseLI CCNNNNNNNGG 1 cut(s) 215
BseMII CTCAG 1 cut(s) 83
BseXI GCAGC 6 cut(s) 10, 38, 39, 117, 131, 250
BseYI CCCAGC 1 cut(s) 48
BsgI GTGCAG 1 cut(s) 249
BshFI GGCC 1 cut(s) 273
BslI CCNNNNNNNGG 1 cut(s) 215
BsnI GGCC 1 cut(s) 273
BspANI GGCC 1 cut(s) 273
BspCNI CTCAG 1 cut(s) 82
BspMAI CTGCAG 1 cut(s) 28
BstC8I GCNNGC 2 cut(s) 179, 183
BstDEI CTNAG 1 cut(s) 69
BstF5I GGATG 2 cut(s) 11, 44
BstH2I RGCGCY 2 cut(s) 111, 125
BstHHI GCGC 2 cut(s) 110, 124
BstMWI GCNNNNNNNGC 3 cut(s) 32, 116, 191
BstSFI CTRYAG 1 cut(s) 24
BstV1I GCAGC 6 cut(s) 10, 38, 39, 117, 131, 250
BsuRI GGCC 1 cut(s) 273
BtsCI GGATG 2 cut(s) 11, 44
Cac8I GCNNGC 2 cut(s) 179, 183
CfoI GCGC 2 cut(s) 110, 124
Cfr13I GGNCC 1 cut(s) 272
CviJI RGCY 6 cut(s) 23, 52, 138, 177, 273, 296
CviKI_1 RGCY 6 cut(s) 23, 52, 138, 177, 273, 296
DdeI CTNAG 1 cut(s) 69
DraIII CACNNNGTG 1 cut(s) 187
EcoO109I RGGNCCY 1 cut(s) 272
FalI AAGNNNNNCTT 2 cut(s) 24, 56
Fnu4HI GCNGC 6 cut(s) 24, 27, 53, 106, 120, 264
FokI GGATG 1 cut(s) 31
Fsp4HI GCNGC 6 cut(s) 24, 27, 53, 106, 120, 264
FspBI CTAG 1 cut(s) 362
GlaI GCGC 2 cut(s) 109, 123
GluI GCNGC 6 cut(s) 24, 27, 53, 106, 120, 264
GsaI CCCAGC 1 cut(s) 52
HaeII RGCGCY 2 cut(s) 111, 125
HaeIII GGCC 1 cut(s) 273
HhaI GCGC 2 cut(s) 110, 124
Hin6I GCGC 2 cut(s) 108, 122
HinP1I GCGC 2 cut(s) 108, 122
HincII GTYRAC 1 cut(s) 339
HindII GTYRAC 1 cut(s) 339
HinfI GANTC 3 cut(s) 73, 79, 221
Hpy166II GTNNAC 1 cut(s) 339
Hpy188I TCNGA 2 cut(s) 72, 78
Hpy8I GTNNAC 1 cut(s) 339
HpyAV CCTTC 1 cut(s) 219
HpyCH4V TGCA 3 cut(s) 26, 194, 266
HpyF10VI GCNNNNNNNGC 3 cut(s) 32, 116, 191
HpyF3I CTNAG 1 cut(s) 69
HspAI GCGC 2 cut(s) 108, 122
LpnPI CCDG 4 cut(s) 62, 163, 225, 282
Lsp1109I GCAGC 6 cut(s) 10, 38, 39, 117, 131, 250
LweI GCATC 3 cut(s) 20, 203, 250
MaeI CTAG 1 cut(s) 362
MboII GAAGA 1 cut(s) 242
MnlI CCTC 5 cut(s) 78, 107, 138, 285, 387
MseI TTAA 2 cut(s) 114, 249
MspA1I CMGCKG 1 cut(s) 52
MwoI GCNNNNNNNGC 3 cut(s) 32, 116, 191
PfeI GAWTC 3 cut(s) 73, 79, 221
PkrI GCNGC 6 cut(s) 25, 28, 54, 107, 121, 265
PspFI CCCAGC 1 cut(s) 48
PspPI GGNCC 1 cut(s) 272
PstI CTGCAG 1 cut(s) 28
PvuII CAGCTG 1 cut(s) 52
SaqAI TTAA 2 cut(s) 114, 249
SatI GCNGC 6 cut(s) 24, 27, 53, 106, 120, 264
Sau96I GGNCC 1 cut(s) 272
SetI ASST 6 cut(s) 54, 70, 140, 179, 244, 385
SfaNI GCATC 3 cut(s) 20, 203, 250
SfcI CTRYAG 1 cut(s) 24
SspMI CTAG 1 cut(s) 362
TaqI TCGA 1 cut(s) 129
TfiI GAWTC 3 cut(s) 73, 79, 221
Tru1I TTAA 2 cut(s) 114, 249
Tru9I TTAA 2 cut(s) 114, 249
TseI GCWGC 6 cut(s) 23, 26, 52, 105, 119, 263
TspDTI ATGAA 2 cut(s) 17, 33
TspGWI ACGGA 2 cut(s) 4, 214
XspI CTAG 1 cut(s) 362
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.