Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp03

Orthogroup ID

OG0014246

Physical Location & Seq

Genomic Coordinates Forward (+)

2588461 .. 2589559

Gene Structure 1099 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.3G035600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 150 bp

ATGACAACGTCGTGGACTGACGACAACTATGTGAGAAGATTTTGGGGTTGCCTCGATTATGGGATAAGAAGAGGTTGTACATTCTTTGAATGGTATGATCCACGAGTATGCAAAAGGTTGAAGATTGTGATACCTAGATTGTTAAAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-GRF

Protein Analysis

50

Amino Acids

6.08

Weight (kDa)

9.57

Isoelectric Point (pI)

33.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014246)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G52603 AT1G67235 AT5G33393
prunus_persica	Prupe.1G215200_v2.0.a1 Prupe.1G219400_v2.0.a1 Prupe.1G276400_v2.0.a1 Prupe.1G465700_v2.0.a1 Prupe.2G069800_v2.0.a1 Prupe.3G035600_v2.0.a1 Prupe.4G259700_v2.0.a1 Prupe.4G259700_v2.0.a1 Prupe.5G025800_v2.0.a1 Prupe.5G194900_v2.0.a1 Prupe.6G151300_v2.0.a1 Prupe.7G055500_v2.0.a1 Prupe.8G073400_v2.0.a1 Prupe.8G093700_v2.0.a1

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	92
AfaI	GTAC	1 cut(s)	79
AgsI	TTSAA	2 cut(s)	89, 121
AlwI	GGATC	1 cut(s)	92
BarI	GAAGNNNNNNTAC	2 cut(s)	61, 93
BauI	CACGAG	1 cut(s)	102
BfaI	CTAG	1 cut(s)	135
Bsp1407I	TGTACA	1 cut(s)	77
Bsp143I	GATC	1 cut(s)	97
BspPI	GGATC	1 cut(s)	92
BsrGI	TGTACA	1 cut(s)	77
BssMI	GATC	1 cut(s)	97
BssSI	CACGAG	1 cut(s)	102
Bst2BI	CACGAG	1 cut(s)	102
Bst6I	CTCTTC	1 cut(s)	64
BstAUI	TGTACA	1 cut(s)	77
BstKTI	GATC	1 cut(s)	100
BstMBI	GATC	1 cut(s)	97
Csp6I	GTAC	1 cut(s)	78
CviQI	GTAC	1 cut(s)	78
DpnI	GATC	1 cut(s)	99
DpnII	GATC	1 cut(s)	97
Eam1104I	CTCTTC	1 cut(s)	64
EarI	CTCTTC	1 cut(s)	64
FaiI	YATR	4 cut(s)	30, 60, 96, 109
FspBI	CTAG	1 cut(s)	135
Hpy166II	GTNNAC	1 cut(s)	15
Hpy8I	GTNNAC	1 cut(s)	15
Hpy99I	CGWCG	1 cut(s)	13
HpyCH4IV	ACGT	1 cut(s)	8
HpyCH4V	TGCA	1 cut(s)	111
HpySE526I	ACGT	1 cut(s)	8
Kzo9I	GATC	1 cut(s)	97
MaeI	CTAG	1 cut(s)	135
MaeII	ACGT	1 cut(s)	8
MalI	GATC	1 cut(s)	99
MboI	GATC	1 cut(s)	97
MboII	GAAGA	3 cut(s)	48, 81, 133
MnlI	CCTC	2 cut(s)	62, 65
MseI	TTAA	1 cut(s)	143
MslI	CAYNNNNRTG	1 cut(s)	106
NdeII	GATC	1 cut(s)	97
PflFI	GACNNNGTC	1 cut(s)	7
PsyI	GACNNNGTC	1 cut(s)	7
RsaI	GTAC	1 cut(s)	79
RsaNI	GTAC	1 cut(s)	78
RseI	CAYNNNNRTG	1 cut(s)	106
SaqAI	TTAA	1 cut(s)	143
Sau3AI	GATC	1 cut(s)	97
SetI	ASST	4 cut(s)	11, 76, 119, 136
SgeI	CNNG	4 cut(s)	24, 65, 114, 116
SmiMI	CAYNNNNRTG	1 cut(s)	106
SspMI	CTAG	1 cut(s)	135
TaiI	ACGT	1 cut(s)	11
TaqI	TCGA	1 cut(s)	54
TatI	WGTACW	1 cut(s)	77
Tru1I	TTAA	1 cut(s)	143
Tru9I	TTAA	1 cut(s)	143
Tth111I	GACNNNGTC	1 cut(s)	7
XspI	CTAG	1 cut(s)	135

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.