Prupe.4G259700_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
OG0014246
Physical Location & Seq
Forward (+)
18636913 .. 18637699
787 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G259700.1

Sequence Viewer

Length: 189 bp
ATGCCCAGTATGCAAGTCTTCCATACCTCAGTCATGTCTTCCATGTCAGGGATGTGTGAGTTCGAAAGGGGAAGGTCGGTGAATGGCTACTATGGACTGAGGACGAAGAGATTCACTTCTTGGACTGATGCGAACCCTGGTAGGAGGTTTGATGTTTGTGGAAAAAAGAATGATAGATGCAGATTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.21

Weight (kDa)

9.92

Isoelectric Point (pI)

50.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 48
AjnI CCWGG 1 cut(s) 136
Asp700I GAANNNNTTC 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 91
AsuII TTCGAA 1 cut(s) 63
BbsI GAAGAC 2 cut(s) 10, 30
BciT130I CCWGG 1 cut(s) 138
BfaI CTAG 1 cut(s) 187
Bme1390I CCNGG 1 cut(s) 138
BmrFI CCNGG 1 cut(s) 138
BmsI GCATC 2 cut(s) 118, 167
BpiI GAAGAC 2 cut(s) 10, 30
Bpu14I TTCGAA 1 cut(s) 63
BsaJI CCNNGG 1 cut(s) 136
Bsc4I CCNNNNNNNGG 1 cut(s) 48
Bse1I ACTGG 1 cut(s) 6
BseBI CCWGG 1 cut(s) 138
BseDI CCNNGG 1 cut(s) 136
BseGI GGATG 1 cut(s) 57
BseLI CCNNNNNNNGG 1 cut(s) 48
BseMII CTCAG 2 cut(s) 42, 89
BseNI ACTGG 1 cut(s) 6
BslI CCNNNNNNNGG 1 cut(s) 48
Bsp119I TTCGAA 1 cut(s) 63
BspCNI CTCAG 2 cut(s) 41, 90
BspT104I TTCGAA 1 cut(s) 63
BsrI ACTGG 1 cut(s) 6
BssECI CCNNGG 1 cut(s) 136
Bst2UI CCWGG 1 cut(s) 138
Bst6I CTCTTC 1 cut(s) 101
BstBI TTCGAA 1 cut(s) 63
BstDEI CTNAG 2 cut(s) 28, 98
BstF5I GGATG 1 cut(s) 57
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstNI CCWGG 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 136
BstV2I GAAGAC 2 cut(s) 10, 30
BtsCI GGATG 1 cut(s) 57
CviAII CATG 2 cut(s) 34, 43
CviJI RGCY 1 cut(s) 87
CviKI_1 RGCY 1 cut(s) 87
DdeI CTNAG 2 cut(s) 28, 98
Eam1104I CTCTTC 1 cut(s) 101
EarI CTCTTC 1 cut(s) 101
EcoRII CCWGG 1 cut(s) 136
FaeI CATG 2 cut(s) 37, 46
FaiI YATR 5 cut(s) 11, 24, 35, 44, 93
FatI CATG 2 cut(s) 33, 42
FokI GGATG 1 cut(s) 64
FspBI CTAG 1 cut(s) 187
Hin1II CATG 2 cut(s) 37, 46
HinfI GANTC 2 cut(s) 111, 183
HphI GGTGA 1 cut(s) 91
HpyAV CCTTC 1 cut(s) 66
HpyCH4V TGCA 2 cut(s) 13, 180
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 2 cut(s) 28, 98
Hsp92II CATG 2 cut(s) 37, 46
LpnPI CCDG 4 cut(s) 19, 33, 123, 150
LweI GCATC 2 cut(s) 118, 167
MaeI CTAG 1 cut(s) 187
MboII GAAGA 3 cut(s) 10, 30, 118
MnlI CCTC 3 cut(s) 37, 93, 138
MroXI GAANNNNTTC 1 cut(s) 110
MspR9I CCNGG 1 cut(s) 138
MvaI CCWGG 1 cut(s) 138
MwoI GCNNNNNNNGC 1 cut(s) 10
NlaIII CATG 2 cut(s) 37, 46
NspV TTCGAA 1 cut(s) 63
PdmI GAANNNNTTC 1 cut(s) 110
PfeI GAWTC 2 cut(s) 111, 183
Psp6I CCWGG 1 cut(s) 136
PspGI CCWGG 1 cut(s) 136
ScrFI CCNGG 1 cut(s) 138
SetI ASST 3 cut(s) 29, 77, 149
SfaNI GCATC 2 cut(s) 118, 167
SfuI TTCGAA 1 cut(s) 63
SgeI CNNG 8 cut(s) 18, 26, 46, 55, 60, 132, 149, 150
SspMI CTAG 1 cut(s) 187
StyD4I CCNGG 1 cut(s) 136
TaqI TCGA 1 cut(s) 63
TfiI GAWTC 2 cut(s) 111, 183
XmnI GAANNNNTTC 1 cut(s) 110
XspI CTAG 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.