Prupe.6G151300_v2.0.a1

GRF zinc finger containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
OG0014246
Physical Location & Seq
Reverse (-)
13092056 .. 13092953
898 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G151300.1

Sequence Viewer

Length: 162 bp
ATGTCGAAAAGAGGCGTTAATAAGGACATCGCGGACAGATTTAAACCATGGAACAAGGTTCTATGTTTGCGGCACATAAGGGAAATGTGCGATCGTTCCAAGCAAGTCATTCCTGGGCTGTTAAGGCGTATTAGAACCATGGAGGAGGAACTTCAGTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-GRF

Protein Analysis

54

Amino Acids

6.41

Weight (kDa)

10.18

Isoelectric Point (pI)

89.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 32
AciI CCGC 2 cut(s) 32, 70
AcuI CTGAAG 1 cut(s) 137
AjnI CCWGG 1 cut(s) 112
BciT130I CCWGG 1 cut(s) 114
BisI GCNGC 1 cut(s) 71
BlsI GCNGC 1 cut(s) 72
Bme1390I CCNGG 1 cut(s) 114
BmrFI CCNGG 1 cut(s) 114
BsaJI CCNNGG 3 cut(s) 47, 113, 138
BseBI CCWGG 1 cut(s) 114
BseDI CCNNGG 3 cut(s) 47, 113, 138
BseRI GAGGAG 1 cut(s) 158
Bsh1236I CGCG 1 cut(s) 32
Bsh1285I CGRYCG 1 cut(s) 94
BsiEI CGRYCG 1 cut(s) 94
Bsp143I GATC 1 cut(s) 91
Bsp19I CCATGG 2 cut(s) 47, 138
BspACI CCGC 2 cut(s) 32, 70
BspFNI CGCG 1 cut(s) 32
BssECI CCNNGG 3 cut(s) 47, 113, 138
BssMI GATC 1 cut(s) 91
BssT1I CCWWGG 2 cut(s) 47, 138
Bst2UI CCWGG 1 cut(s) 114
BstDSI CCRYGG 2 cut(s) 47, 138
BstFNI CGCG 1 cut(s) 32
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstMCI CGRYCG 1 cut(s) 94
BstMWI GCNNNNNNNGC 1 cut(s) 124
BstNI CCWGG 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 112
BstUI CGCG 1 cut(s) 32
BtgI CCRYGG 2 cut(s) 47, 138
BtgZI GCGATG 1 cut(s) 13
CviAII CATG 2 cut(s) 48, 139
CviJI RGCY 1 cut(s) 118
CviKI_1 RGCY 1 cut(s) 118
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
DraI TTTAAA 1 cut(s) 43
Eco130I CCWWGG 2 cut(s) 47, 138
Eco57I CTGAAG 1 cut(s) 137
EcoRII CCWGG 1 cut(s) 112
EcoT14I CCWWGG 2 cut(s) 47, 138
ErhI CCWWGG 2 cut(s) 47, 138
FaeI CATG 2 cut(s) 51, 142
FaiI YATR 4 cut(s) 49, 64, 77, 140
FatI CATG 2 cut(s) 47, 138
Fnu4HI GCNGC 1 cut(s) 71
Fsp4HI GCNGC 1 cut(s) 71
GluI GCNGC 1 cut(s) 71
Hin1II CATG 2 cut(s) 51, 142
HpyF10VI GCNNNNNNNGC 1 cut(s) 124
Hsp92II CATG 2 cut(s) 51, 142
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 2 cut(s) 99, 126
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MnlI CCTC 3 cut(s) 5, 136, 139
MseI TTAA 3 cut(s) 18, 42, 122
MspR9I CCNGG 1 cut(s) 114
MvaI CCWGG 1 cut(s) 114
MvnI CGCG 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 124
NcoI CCATGG 2 cut(s) 47, 138
NdeII GATC 1 cut(s) 91
NlaIII CATG 2 cut(s) 51, 142
PkrI GCNGC 1 cut(s) 72
Ple19I CGATCG 1 cut(s) 94
Psp6I CCWGG 1 cut(s) 112
PspGI CCWGG 1 cut(s) 112
PvuI CGATCG 1 cut(s) 94
SaqAI TTAA 3 cut(s) 18, 42, 122
SatI GCNGC 1 cut(s) 71
Sau3AI GATC 1 cut(s) 91
ScrFI CCNGG 1 cut(s) 114
SetI ASST 1 cut(s) 60
SgeI CNNG 8 cut(s) 43, 60, 67, 112, 116, 125, 126, 151
SsiI CCGC 2 cut(s) 32, 70
StyD4I CCNGG 1 cut(s) 112
StyI CCWWGG 2 cut(s) 47, 138
TaqI TCGA 1 cut(s) 5
TauI GCSGC 1 cut(s) 73
Tru1I TTAA 3 cut(s) 18, 42, 122
Tru9I TTAA 3 cut(s) 18, 42, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.