Prupe.5G025800_v2.0.a1

GRF zinc finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
OG0014246
Physical Location & Seq
Reverse (-)
2911978 .. 2912190
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G025800.1

Sequence Viewer

Length: 213 bp
ATGTCTGCAAATCGAAGATGCGAAGTAGGCCAGCCCATTTGTCACTACGATAATCAATGTTGTCTGACGACGTCGTGGACTAACAACAACCCTGGGAGAAGATTTTGGGGCTGCGCCCACTATGGGGTAAGAAGAGGTTGTGCATTCTTTGAATGGTATGATCCACAAGTATGCGAAAGGTCCAAGATTGTGATATGTGGACTATTGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-GRF

Protein Analysis

71

Amino Acids

8.15

Weight (kDa)

8.72

Isoelectric Point (pI)

59.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 74
AclWI GGATC 1 cut(s) 155
AcyI GRCGYC 1 cut(s) 71
AfiI CCNNNNNNNGG 2 cut(s) 123, 124
AgsI TTSAA 2 cut(s) 152, 208
AjnI CCWGG 1 cut(s) 91
AlwI GGATC 1 cut(s) 155
AoxI GGCC 1 cut(s) 28
ApeKI GCWGC 1 cut(s) 111
AspLEI GCGC 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 180
AvaII GGWCC 1 cut(s) 180
BbvI GCAGC 1 cut(s) 98
BciT130I CCWGG 1 cut(s) 93
BisI GCNGC 1 cut(s) 112
BlsI GCNGC 1 cut(s) 113
Bme1390I CCNGG 1 cut(s) 93
Bme18I GGWCC 1 cut(s) 180
BmgT120I GGNCC 1 cut(s) 180
BmrFI CCNGG 1 cut(s) 93
BmsI GCATC 1 cut(s) 8
BsaHI GRCGYC 1 cut(s) 71
BsaJI CCNNGG 2 cut(s) 91, 92
Bsc4I CCNNNNNNNGG 2 cut(s) 123, 124
BseBI CCWGG 1 cut(s) 93
BseDI CCNNGG 2 cut(s) 91, 92
BseLI CCNNNNNNNGG 2 cut(s) 123, 124
BseXI GCAGC 1 cut(s) 98
BshFI GGCC 1 cut(s) 30
BslI CCNNNNNNNGG 2 cut(s) 123, 124
BsmI GAATGC 1 cut(s) 143
BsnI GGCC 1 cut(s) 30
Bsp143I GATC 1 cut(s) 160
BspANI GGCC 1 cut(s) 30
BspPI GGATC 1 cut(s) 155
BssECI CCNNGG 2 cut(s) 91, 92
BssMI GATC 1 cut(s) 160
BssNI GRCGYC 1 cut(s) 71
Bst2UI CCWGG 1 cut(s) 93
Bst6I CTCTTC 1 cut(s) 127
BstACI GRCGYC 1 cut(s) 71
BstC8I GCNNGC 1 cut(s) 32
BstHHI GCGC 1 cut(s) 116
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstMWI GCNNNNNNNGC 1 cut(s) 27
BstNI CCWGG 1 cut(s) 93
BstSCI CCNGG 1 cut(s) 91
BstV1I GCAGC 1 cut(s) 98
BsuRI GGCC 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 32
CfoI GCGC 1 cut(s) 116
Cfr13I GGNCC 1 cut(s) 180
CviJI RGCY 3 cut(s) 30, 34, 111
CviKI_1 RGCY 3 cut(s) 30, 34, 111
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
Eam1104I CTCTTC 1 cut(s) 127
EarI CTCTTC 1 cut(s) 127
Eco47I GGWCC 1 cut(s) 180
EcoRII CCWGG 1 cut(s) 91
FaiI YATR 4 cut(s) 123, 159, 172, 196
Fnu4HI GCNGC 1 cut(s) 112
Fsp4HI GCNGC 1 cut(s) 112
GlaI GCGC 1 cut(s) 115
GluI GCNGC 1 cut(s) 112
HaeIII GGCC 1 cut(s) 30
HhaI GCGC 1 cut(s) 116
Hin1I GRCGYC 1 cut(s) 71
Hin6I GCGC 1 cut(s) 114
HinP1I GCGC 1 cut(s) 114
Hpy166II GTNNAC 2 cut(s) 78, 200
Hpy188I TCNGA 1 cut(s) 66
Hpy8I GTNNAC 2 cut(s) 78, 200
Hpy99I CGWCG 2 cut(s) 73, 76
HpyCH4IV ACGT 1 cut(s) 71
HpyCH4V TGCA 2 cut(s) 8, 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 27
HpySE526I ACGT 1 cut(s) 71
Hsp92I GRCGYC 1 cut(s) 71
HspAI GCGC 1 cut(s) 114
Kzo9I GATC 1 cut(s) 160
LpnPI CCDG 3 cut(s) 44, 78, 105
Lsp1109I GCAGC 1 cut(s) 98
LweI GCATC 1 cut(s) 8
MaeII ACGT 1 cut(s) 71
MaeIII GTNAC 1 cut(s) 41
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 3 cut(s) 27, 111, 144
MnlI CCTC 1 cut(s) 128
MslI CAYNNNNRTG 1 cut(s) 169
MspR9I CCNGG 1 cut(s) 93
Mva1269I GAATGC 1 cut(s) 143
MvaI CCWGG 1 cut(s) 93
MwoI GCNNNNNNNGC 1 cut(s) 27
NdeII GATC 1 cut(s) 160
NmuCI GTSAC 1 cut(s) 41
PasI CCCWGGG 1 cut(s) 92
PctI GAATGC 1 cut(s) 143
PflFI GACNNNGTC 1 cut(s) 70
PkrI GCNGC 1 cut(s) 113
Psp6I CCWGG 1 cut(s) 91
PspGI CCWGG 1 cut(s) 91
PspPI GGNCC 1 cut(s) 180
PsyI GACNNNGTC 1 cut(s) 70
RseI CAYNNNNRTG 1 cut(s) 169
SatI GCNGC 1 cut(s) 112
Sau3AI GATC 1 cut(s) 160
Sau96I GGNCC 1 cut(s) 180
ScrFI CCNGG 1 cut(s) 93
SetI ASST 3 cut(s) 74, 139, 182
SfaNI GCATC 1 cut(s) 8
SgeI CNNG 6 cut(s) 43, 87, 104, 105, 179, 196
SinI GGWCC 1 cut(s) 180
SmiMI CAYNNNNRTG 1 cut(s) 169
StyD4I CCNGG 1 cut(s) 91
TaiI ACGT 1 cut(s) 74
TaqI TCGA 1 cut(s) 13
TseFI GTSAC 1 cut(s) 41
TseI GCWGC 1 cut(s) 111
Tsp45I GTSAC 1 cut(s) 41
Tth111I GACNNNGTC 1 cut(s) 70
VpaK11BI GGWCC 1 cut(s) 180
ZraI GACGTC 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.