Prupe.5G071800_v2.0.a1

Domain of unknown function (DUF4535)

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Reverse (-)
8671004 .. 8671183
180 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G071800.1

Sequence Viewer

Length: 180 bp
ATGGGCATAATGGGAAGCTGCTTCTCGTTTATATTGGGCTCAGTGTTCGGCATCTACGTTGCCCAAAACTACAACATCCCCAACATCCAGAAGCTCTCCACTAAGGGCCTCTTGATCGCCAAGCACATCGAAGAGACTTACTGGAAGCTTAAGAAGAGAGACGACGAGAACCAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.77

Weight (kDa)

8.85

Isoelectric Point (pI)

47.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 149
AluBI AGCT 3 cut(s) 18, 94, 148
AluI AGCT 3 cut(s) 18, 94, 148
Alw26I GTCTC 2 cut(s) 128, 153
AoxI GGCC 1 cut(s) 106
ApeKI GCWGC 1 cut(s) 18
AspS9I GGNCC 1 cut(s) 106
BanII GRGCYC 1 cut(s) 41
BbvI GCAGC 1 cut(s) 5
BcoDI GTCTC 2 cut(s) 128, 153
BfaI CTAG 1 cut(s) 178
BfrI CTTAAG 1 cut(s) 149
BisI GCNGC 1 cut(s) 19
BlsI GCNGC 1 cut(s) 20
BmgT120I GGNCC 1 cut(s) 106
BmsI GCATC 1 cut(s) 60
Bse1I ACTGG 1 cut(s) 146
BseGI GGATG 2 cut(s) 75, 84
BseMII CTCAG 1 cut(s) 54
BseNI ACTGG 1 cut(s) 146
BseXI GCAGC 1 cut(s) 5
BshFI GGCC 1 cut(s) 108
BsmAI GTCTC 2 cut(s) 128, 153
BsmBI CGTCTC 1 cut(s) 153
BsnI GGCC 1 cut(s) 108
Bsp1286I GDGCHC 1 cut(s) 41
Bsp143I GATC 1 cut(s) 114
BspANI GGCC 1 cut(s) 108
BspCNI CTCAG 1 cut(s) 53
BspTI CTTAAG 1 cut(s) 149
BsrI ACTGG 1 cut(s) 146
BssMI GATC 1 cut(s) 114
Bst6I CTCTTC 2 cut(s) 126, 149
BstAFI CTTAAG 1 cut(s) 149
BstDEI CTNAG 2 cut(s) 40, 102
BstF5I GGATG 2 cut(s) 75, 84
BstKTI GATC 1 cut(s) 117
BstMAI GTCTC 2 cut(s) 128, 153
BstMBI GATC 1 cut(s) 114
BstV1I GCAGC 1 cut(s) 5
BsuRI GGCC 1 cut(s) 108
BtsCI GGATG 2 cut(s) 75, 84
BtsIMutI CAGTG 1 cut(s) 48
Cfr13I GGNCC 1 cut(s) 106
CviJI RGCY 5 cut(s) 18, 39, 94, 108, 148
CviKI_1 RGCY 5 cut(s) 18, 39, 94, 108, 148
DdeI CTNAG 2 cut(s) 40, 102
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
Eam1104I CTCTTC 2 cut(s) 126, 149
EarI CTCTTC 2 cut(s) 126, 149
Eco24I GRGCYC 1 cut(s) 41
EcoO109I RGGNCCY 1 cut(s) 106
EcoT38I GRGCYC 1 cut(s) 41
Esp3I CGTCTC 1 cut(s) 153
FaiI YATR 2 cut(s) 8, 32
FalI AAGNNNNNCTT 2 cut(s) 95, 127
Fnu4HI GCNGC 1 cut(s) 19
FokI GGATG 2 cut(s) 62, 71
FriOI GRGCYC 1 cut(s) 41
Fsp4HI GCNGC 1 cut(s) 19
FspBI CTAG 1 cut(s) 178
GluI GCNGC 1 cut(s) 19
HaeIII GGCC 1 cut(s) 108
HindIII AAGCTT 1 cut(s) 146
Hpy188III TCNNGA 2 cut(s) 88, 112
Hpy99I CGWCG 1 cut(s) 167
HpyCH4IV ACGT 1 cut(s) 57
HpyF3I CTNAG 2 cut(s) 40, 102
HpySE526I ACGT 1 cut(s) 57
Kzo9I GATC 1 cut(s) 114
LpnPI CCDG 2 cut(s) 101, 127
Lsp1109I GCAGC 1 cut(s) 5
LweI GCATC 1 cut(s) 60
MaeI CTAG 1 cut(s) 178
MaeII ACGT 1 cut(s) 57
MalI GATC 1 cut(s) 116
MboI GATC 1 cut(s) 114
MboII GAAGA 2 cut(s) 143, 166
MhlI GDGCHC 1 cut(s) 41
MnlI CCTC 1 cut(s) 119
MseI TTAA 1 cut(s) 150
MspCI CTTAAG 1 cut(s) 149
NdeII GATC 1 cut(s) 114
PcsI WCGNNNNNNNCGW 1 cut(s) 54
PkrI GCNGC 1 cut(s) 20
PspPI GGNCC 1 cut(s) 106
SaqAI TTAA 1 cut(s) 150
SatI GCNGC 1 cut(s) 19
Sau3AI GATC 1 cut(s) 114
Sau96I GGNCC 1 cut(s) 106
SduI GDGCHC 1 cut(s) 41
SetI ASST 4 cut(s) 20, 60, 96, 150
SfaNI GCATC 1 cut(s) 60
SgeI CNNG 5 cut(s) 37, 100, 124, 133, 154
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
SspMI CTAG 1 cut(s) 178
TaiI ACGT 1 cut(s) 60
TaqI TCGA 1 cut(s) 129
Tru1I TTAA 1 cut(s) 150
Tru9I TTAA 1 cut(s) 150
TscAI CASTG 1 cut(s) 48
TseI GCWGC 1 cut(s) 18
TspRI CASTG 1 cut(s) 48
Vha464I CTTAAG 1 cut(s) 149
XspI CTAG 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.