Rh3CG015500

Domain of unknown function (DUF4535)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0007078
Physical Location & Seq
Reverse (-)
1043721 .. 1044175
455 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG015500.1

Sequence Viewer

Length: 324 bp
ATGGTGAAGAAAGAGTTGCAAAAGAGCTTTGCTTGTTCGACATCATTTTCAACCTGGAAGGCTCCGATCTACCAAAGGCCCCAACTTCCCAATGTCGCAATCTCTCAATCTTTTGGGTTTCACAAAGTTGAGATTGAAGATGGTTGCCAAGTTGTGGGTTTTGATTACTTTGAAGAACTTTTGGTCGGAATCTACGTCTCTCAGAACGATAACGTCCCCAACATCGATAAGTTTGCCAAGACCTTCCTCCTAATCGGCAACCTCGAAGAGACTTACCGGAAGCCCAAGAAAAGGGAGAGAGACGAGATCGAGATCAAGATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4535

Protein Analysis

107

Amino Acids

12.42

Weight (kDa)

6.58

Isoelectric Point (pI)

55.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4535 PF15054 61 - 95 1.1e-08 Domain of unknown function (DUF4535)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 154
AfiI CCNNNNNNNGG 2 cut(s) 154, 291
AgsI TTSAA 3 cut(s) 51, 137, 173
AjnI CCWGG 1 cut(s) 53
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
Alw26I GTCTC 3 cut(s) 202, 263, 294
AoxI GGCC 1 cut(s) 77
AspS9I GGNCC 1 cut(s) 78
AsuHPI GGTGA 1 cut(s) 16
BccI CCATC 1 cut(s) 134
BcgI CGANNNNNNTGC 2 cut(s) 215, 249
BciT130I CCWGG 1 cut(s) 55
BcoDI GTCTC 3 cut(s) 202, 263, 294
BfaI CTAG 1 cut(s) 322
BglII AGATCT 1 cut(s) 318
Bme1390I CCNGG 1 cut(s) 55
BmgT120I GGNCC 1 cut(s) 78
BmiI GGNNCC 2 cut(s) 63, 80
BmrFI CCNGG 1 cut(s) 55
Bsa29I ATCGAT 1 cut(s) 225
BsaBI GATNNNNATC 2 cut(s) 311, 317
BsaWI WCCGGW 1 cut(s) 276
Bsc4I CCNNNNNNNGG 2 cut(s) 154, 291
Bse8I GATNNNNATC 2 cut(s) 311, 317
BseBI CCWGG 1 cut(s) 55
BseCI ATCGAT 1 cut(s) 225
BseJI GATNNNNATC 2 cut(s) 311, 317
BseLI CCNNNNNNNGG 2 cut(s) 154, 291
BseMII CTCAG 1 cut(s) 215
BshFI GGCC 1 cut(s) 79
BshVI ATCGAT 1 cut(s) 225
BsiSI CCGG 1 cut(s) 277
BslFI GGGAC 1 cut(s) 200
BslI CCNNNNNNNGG 2 cut(s) 154, 291
BsmAI GTCTC 3 cut(s) 202, 263, 294
BsmBI CGTCTC 2 cut(s) 202, 294
BsmFI GGGAC 1 cut(s) 200
BsnI GGCC 1 cut(s) 79
Bsp143I GATC 4 cut(s) 66, 306, 312, 318
BspANI GGCC 1 cut(s) 79
BspCNI CTCAG 1 cut(s) 214
BspDI ATCGAT 1 cut(s) 225
BspLI GGNNCC 2 cut(s) 63, 80
BssMI GATC 4 cut(s) 66, 306, 312, 318
Bst2UI CCWGG 1 cut(s) 55
Bst6I CTCTTC 1 cut(s) 261
BstDEI CTNAG 1 cut(s) 201
BstKTI GATC 4 cut(s) 69, 309, 315, 321
BstMAI GTCTC 3 cut(s) 202, 263, 294
BstMBI GATC 4 cut(s) 66, 306, 312, 318
BstNI CCWGG 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 53
BstX2I RGATCY 1 cut(s) 318
BstYI RGATCY 1 cut(s) 318
Bsu15I ATCGAT 1 cut(s) 225
BsuRI GGCC 1 cut(s) 79
BsuTUI ATCGAT 1 cut(s) 225
Cfr13I GGNCC 1 cut(s) 78
ClaI ATCGAT 1 cut(s) 225
CviJI RGCY 4 cut(s) 27, 62, 79, 283
CviKI_1 RGCY 4 cut(s) 27, 62, 79, 283
DdeI CTNAG 1 cut(s) 201
DpnI GATC 4 cut(s) 68, 308, 314, 320
DpnII GATC 4 cut(s) 66, 306, 312, 318
Eam1104I CTCTTC 1 cut(s) 261
EarI CTCTTC 1 cut(s) 261
EcoO109I RGGNCCY 1 cut(s) 78
EcoRII CCWGG 1 cut(s) 53
Esp3I CGTCTC 2 cut(s) 202, 294
FaqI GGGAC 1 cut(s) 200
FspBI CTAG 1 cut(s) 322
HaeIII GGCC 1 cut(s) 79
HapII CCGG 1 cut(s) 277
HinfI GANTC 1 cut(s) 189
HpaII CCGG 1 cut(s) 277
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 3 cut(s) 66, 188, 204
Hpy188III TCNNGA 2 cut(s) 310, 316
HpyAV CCTTC 2 cut(s) 52, 253
HpyCH4IV ACGT 2 cut(s) 195, 213
HpyCH4V TGCA 1 cut(s) 19
HpyF3I CTNAG 1 cut(s) 201
HpySE526I ACGT 2 cut(s) 195, 213
Kzo9I GATC 4 cut(s) 66, 306, 312, 318
LmnI GCTCC 1 cut(s) 67
LpnPI CCDG 3 cut(s) 40, 67, 290
MaeI CTAG 1 cut(s) 322
MaeII ACGT 2 cut(s) 195, 213
MalI GATC 4 cut(s) 68, 308, 314, 320
MboI GATC 4 cut(s) 66, 306, 312, 318
MboII GAAGA 4 cut(s) 19, 149, 185, 278
MflI RGATCY 1 cut(s) 318
MmeI TCCRAC 1 cut(s) 166
MnlI CCTC 2 cut(s) 257, 272
MspI CCGG 1 cut(s) 277
MspR9I CCNGG 1 cut(s) 55
MvaI CCWGG 1 cut(s) 55
NdeII GATC 4 cut(s) 66, 306, 312, 318
NlaIV GGNNCC 2 cut(s) 63, 80
PcsI WCGNNNNNNNCGW 2 cut(s) 192, 261
PfeI GAWTC 1 cut(s) 189
PflMI CCANNNNNTGG 1 cut(s) 154
Psp6I CCWGG 1 cut(s) 53
PspGI CCWGG 1 cut(s) 53
PspN4I GGNNCC 2 cut(s) 63, 80
PspPI GGNCC 1 cut(s) 78
PsuI RGATCY 1 cut(s) 318
Sau3AI GATC 4 cut(s) 66, 306, 312, 318
Sau96I GGNCC 1 cut(s) 78
ScrFI CCNGG 1 cut(s) 55
SetI ASST 6 cut(s) 29, 56, 198, 216, 245, 264
SgeI CNNG 9 cut(s) 45, 66, 67, 161, 250, 275, 289, 298, 316
SspMI CTAG 1 cut(s) 322
StyD4I CCNGG 1 cut(s) 53
TaiI ACGT 2 cut(s) 198, 216
TaqI TCGA 4 cut(s) 38, 225, 264, 309
TfiI GAWTC 1 cut(s) 189
Van91I CCANNNNNTGG 1 cut(s) 154
XspI CTAG 1 cut(s) 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.