Rw2G024660

Domain of unknown function (DUF4535)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
OG0007078
Physical Location & Seq
Reverse (-)
36430375 .. 36430623
249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G024660.1

Sequence Viewer

Length: 249 bp
ATGGGTTTTGTGTGGTTGGTTGTTGTTAATTTTCAGTTTGGGTTTCACAAAGTTGAGATTGAAGATGGTTGCCAAGTTGTGGGTTTTGATTACTTTGAAGAAATTTTGGTCGGAATCTACGTCTCTCAGAACGATAACGTCCCCAACATCGATAAGTTTGCCAAGACCTTCCTCCTAATCGGCAACCTCGAAGAGACTTACCGGAAGCCCAAGAAAAGGGAGAGAGACGAGATCGAGATCAAGATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4535

Protein Analysis

82

Amino Acids

9.66

Weight (kDa)

4.89

Isoelectric Point (pI)

48.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4535 PF15054 36 - 70 4.1e-09 Domain of unknown function (DUF4535)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 79
AcsI RAATTY 1 cut(s) 102
AfiI CCNNNNNNNGG 2 cut(s) 79, 216
AgsI TTSAA 2 cut(s) 62, 98
Alw26I GTCTC 3 cut(s) 127, 188, 219
ApoI RAATTY 1 cut(s) 102
BccI CCATC 1 cut(s) 59
BcgI CGANNNNNNTGC 2 cut(s) 140, 174
BcoDI GTCTC 3 cut(s) 127, 188, 219
BfaI CTAG 1 cut(s) 247
BglII AGATCT 1 cut(s) 243
Bsa29I ATCGAT 1 cut(s) 150
BsaBI GATNNNNATC 2 cut(s) 236, 242
BsaWI WCCGGW 1 cut(s) 201
Bsc4I CCNNNNNNNGG 2 cut(s) 79, 216
Bse8I GATNNNNATC 2 cut(s) 236, 242
BseCI ATCGAT 1 cut(s) 150
BseJI GATNNNNATC 2 cut(s) 236, 242
BseLI CCNNNNNNNGG 2 cut(s) 79, 216
BseMII CTCAG 1 cut(s) 140
BshVI ATCGAT 1 cut(s) 150
BsiSI CCGG 1 cut(s) 202
BslFI GGGAC 1 cut(s) 125
BslI CCNNNNNNNGG 2 cut(s) 79, 216
BsmAI GTCTC 3 cut(s) 127, 188, 219
BsmBI CGTCTC 2 cut(s) 127, 219
BsmFI GGGAC 1 cut(s) 125
Bsp143I GATC 3 cut(s) 231, 237, 243
BspCNI CTCAG 1 cut(s) 139
BspDI ATCGAT 1 cut(s) 150
BssMI GATC 3 cut(s) 231, 237, 243
Bst6I CTCTTC 1 cut(s) 186
BstDEI CTNAG 1 cut(s) 126
BstKTI GATC 3 cut(s) 234, 240, 246
BstMAI GTCTC 3 cut(s) 127, 188, 219
BstMBI GATC 3 cut(s) 231, 237, 243
BstX2I RGATCY 1 cut(s) 243
BstYI RGATCY 1 cut(s) 243
Bsu15I ATCGAT 1 cut(s) 150
BsuTUI ATCGAT 1 cut(s) 150
ClaI ATCGAT 1 cut(s) 150
CviJI RGCY 1 cut(s) 208
CviKI_1 RGCY 1 cut(s) 208
DdeI CTNAG 1 cut(s) 126
DpnI GATC 3 cut(s) 233, 239, 245
DpnII GATC 3 cut(s) 231, 237, 243
Eam1104I CTCTTC 1 cut(s) 186
EarI CTCTTC 1 cut(s) 186
Esp3I CGTCTC 2 cut(s) 127, 219
FaqI GGGAC 1 cut(s) 125
FspBI CTAG 1 cut(s) 247
HapII CCGG 1 cut(s) 202
HinfI GANTC 1 cut(s) 114
HpaII CCGG 1 cut(s) 202
Hpy188I TCNGA 2 cut(s) 113, 129
Hpy188III TCNNGA 2 cut(s) 235, 241
HpyAV CCTTC 1 cut(s) 178
HpyCH4IV ACGT 2 cut(s) 120, 138
HpyF3I CTNAG 1 cut(s) 126
HpySE526I ACGT 2 cut(s) 120, 138
Kzo9I GATC 3 cut(s) 231, 237, 243
LpnPI CCDG 1 cut(s) 215
MaeI CTAG 1 cut(s) 247
MaeII ACGT 2 cut(s) 120, 138
MalI GATC 3 cut(s) 233, 239, 245
MboI GATC 3 cut(s) 231, 237, 243
MboII GAAGA 3 cut(s) 74, 110, 203
MflI RGATCY 1 cut(s) 243
MluCI AATT 2 cut(s) 28, 102
MmeI TCCRAC 1 cut(s) 91
MnlI CCTC 2 cut(s) 182, 197
MseI TTAA 1 cut(s) 27
MspI CCGG 1 cut(s) 202
NdeII GATC 3 cut(s) 231, 237, 243
PcsI WCGNNNNNNNCGW 2 cut(s) 117, 186
PfeI GAWTC 1 cut(s) 114
PflMI CCANNNNNTGG 1 cut(s) 79
PsuI RGATCY 1 cut(s) 243
SaqAI TTAA 1 cut(s) 27
Sau3AI GATC 3 cut(s) 231, 237, 243
SetI ASST 4 cut(s) 123, 141, 170, 189
SgeI CNNG 6 cut(s) 86, 175, 200, 214, 223, 241
Sse9I AATT 2 cut(s) 28, 102
SspMI CTAG 1 cut(s) 247
TaiI ACGT 2 cut(s) 123, 141
TaqI TCGA 3 cut(s) 150, 189, 234
TasI AATT 2 cut(s) 28, 102
TfiI GAWTC 1 cut(s) 114
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
Van91I CCANNNNNTGG 1 cut(s) 79
XapI RAATTY 1 cut(s) 102
XspI CTAG 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.