Rh3DG300300

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0007078
Physical Location & Seq
Reverse (-)
31609956 .. 31625972
16017 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG300300.1

Sequence Viewer

Length: 303 bp
ATGAAACTAAGTCGAGTCAAACAAATTCGACAAGTTGTAGAAGAGAAACTTGAGTCTGGACAGGGGAAGACAACTTTCCGCCGTTTCTTTTCTAGATTTTGTACACCAATCTTTTTGGAGTCATTCGTTCTAACATTTTTAGCTGAGTGGGGAGATCGTAGCCAAATAGCGACAATCGCTATATTGAGGAAAATCTGTTGGTACTTGGTTCTGTCACCATACGATCCAATGCAGTCAAGCCTTCTTAATTCTACCCTGGAGGATAAGAATCTTTCAGAGAGTCCAAATTTTAGGAAATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DYW_deaminase PPR PPR_2 UPF0016

Protein Analysis

100

Amino Acids

11.7

Weight (kDa)

9.56

Isoelectric Point (pI)

60.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GDT1 PF01169 39 - 61 9.8e-07 Divalent cation/proton antiporter GDT1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AclWI GGATC 1 cut(s) 218
AcsI RAATTY 2 cut(s) 24, 286
AfaI GTAC 2 cut(s) 103, 203
AjnI CCWGG 1 cut(s) 255
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
AlwI GGATC 1 cut(s) 218
ApoI RAATTY 2 cut(s) 24, 286
AsuHPI GGTGA 1 cut(s) 207
BbsI GAAGAC 1 cut(s) 74
BceAI ACGGC 1 cut(s) 66
BciT130I CCWGG 1 cut(s) 257
BfaI CTAG 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 257
BmrFI CCNGG 1 cut(s) 257
BpiI GAAGAC 1 cut(s) 74
BpmI CTGGAG 1 cut(s) 278
BpuEI CTTGAG 1 cut(s) 71
BsaBI GATNNNNATC 1 cut(s) 267
BsaJI CCNNGG 1 cut(s) 255
Bse8I GATNNNNATC 1 cut(s) 267
BseBI CCWGG 1 cut(s) 257
BseDI CCNNGG 1 cut(s) 255
BseJI GATNNNNATC 1 cut(s) 267
BseMII CTCAG 1 cut(s) 135
Bsp1407I TGTACA 1 cut(s) 101
Bsp143I GATC 2 cut(s) 154, 223
BspACI CCGC 1 cut(s) 79
BspCNI CTCAG 1 cut(s) 136
BspPI GGATC 1 cut(s) 218
BsrGI TGTACA 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 255
BssMI GATC 2 cut(s) 154, 223
Bst2UI CCWGG 1 cut(s) 257
Bst6I CTCTTC 1 cut(s) 36
BstAUI TGTACA 1 cut(s) 101
BstDEI CTNAG 2 cut(s) 8, 144
BstKTI GATC 2 cut(s) 157, 226
BstMBI GATC 2 cut(s) 154, 223
BstMWI GCNNNNNNNGC 1 cut(s) 176
BstNI CCWGG 1 cut(s) 257
BstSCI CCNGG 1 cut(s) 255
BstV2I GAAGAC 1 cut(s) 74
Csp6I GTAC 2 cut(s) 102, 202
CviJI RGCY 3 cut(s) 143, 162, 240
CviKI_1 RGCY 3 cut(s) 143, 162, 240
CviQI GTAC 2 cut(s) 102, 202
DdeI CTNAG 2 cut(s) 8, 144
DpnI GATC 2 cut(s) 156, 225
DpnII GATC 2 cut(s) 154, 223
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
EciI GGCGGA 1 cut(s) 68
EcoRII CCWGG 1 cut(s) 255
FaiI YATR 2 cut(s) 182, 220
FalI AAGNNNNNCTT 2 cut(s) 33, 65
FspBI CTAG 1 cut(s) 93
GsuI CTGGAG 1 cut(s) 278
HinfI GANTC 5 cut(s) 15, 53, 119, 268, 280
HphI GGTGA 1 cut(s) 207
Hpy166II GTNNAC 1 cut(s) 104
Hpy188I TCNGA 1 cut(s) 277
Hpy188III TCNNGA 3 cut(s) 57, 93, 300
Hpy8I GTNNAC 1 cut(s) 104
HpyAV CCTTC 1 cut(s) 251
HpyCH4V TGCA 1 cut(s) 232
HpyF10VI GCNNNNNNNGC 1 cut(s) 176
HpyF3I CTNAG 2 cut(s) 8, 144
Kzo9I GATC 2 cut(s) 154, 223
LpnPI CCDG 4 cut(s) 42, 47, 242, 269
MaeI CTAG 1 cut(s) 93
MaeIII GTNAC 1 cut(s) 213
MalI GATC 2 cut(s) 156, 225
MboI GATC 2 cut(s) 154, 223
MboII GAAGA 2 cut(s) 53, 79
MluCI AATT 3 cut(s) 24, 247, 286
MlyI GAGTC 4 cut(s) 24, 62, 128, 289
MnlI CCTC 2 cut(s) 180, 253
MseI TTAA 1 cut(s) 246
MspR9I CCNGG 1 cut(s) 257
MvaI CCWGG 1 cut(s) 257
MwoI GCNNNNNNNGC 1 cut(s) 176
NdeII GATC 2 cut(s) 154, 223
NmuCI GTSAC 1 cut(s) 213
PfeI GAWTC 1 cut(s) 268
PleI GAGTC 4 cut(s) 23, 61, 127, 288
PpsI GAGTC 4 cut(s) 23, 61, 127, 288
Psp6I CCWGG 1 cut(s) 255
PspGI CCWGG 1 cut(s) 255
RsaI GTAC 2 cut(s) 103, 203
RsaNI GTAC 2 cut(s) 102, 202
SaqAI TTAA 1 cut(s) 246
Sau3AI GATC 2 cut(s) 154, 223
SchI GAGTC 4 cut(s) 24, 62, 128, 289
ScrFI CCNGG 1 cut(s) 257
SetI ASST 1 cut(s) 145
SmlI CTYRAG 1 cut(s) 50
SmoI CTYRAG 1 cut(s) 50
Sse9I AATT 3 cut(s) 24, 247, 286
SsiI CCGC 1 cut(s) 79
SspMI CTAG 1 cut(s) 93
StyD4I CCNGG 1 cut(s) 255
TaqI TCGA 2 cut(s) 13, 28
TasI AATT 3 cut(s) 24, 247, 286
TatI WGTACW 1 cut(s) 101
TfiI GAWTC 1 cut(s) 268
Tru1I TTAA 1 cut(s) 246
Tru9I TTAA 1 cut(s) 246
TseFI GTSAC 1 cut(s) 213
Tsp45I GTSAC 1 cut(s) 213
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 2 cut(s) 24, 286
XbaI TCTAGA 1 cut(s) 92
XspI CTAG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.