Rmu_sc0008159.1_g000013

BEST Arabidopsis thaliana protein match is

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008159.1
Physical Location & Seq
Reverse (-)
48694 .. 49580
887 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008159.1_g000013.1.cds

Sequence Viewer

Length: 276 bp
atgccccttttggctttgtcacacaagtttcgagtacgacaagaaaaagacattacttctaagcctagcaattgccccttcgagtggattgcaatggggtttttcagaagcaccttctcgtttctgaccggcacggtggtcggagtctacgtcgctcagaattacaacgtccccaacatcgataagctcgccaagaccttcctcctgatcggcaagcacctcgaggagacttaccggaagcccaagaagagggacagcgacgggagcgaggtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.44

Weight (kDa)

9.56

Isoelectric Point (pI)

41.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 221
AccI GTMKAC 1 cut(s) 147
AfaI GTAC 1 cut(s) 36
AfiI CCNNNNNNNGG 2 cut(s) 84, 249
AluBI AGCT 1 cut(s) 187
AluI AGCT 1 cut(s) 187
Alw26I GTCTC 1 cut(s) 221
Ama87I CYCGRG 1 cut(s) 221
AvaI CYCGRG 1 cut(s) 221
BcgI CGANNNNNNTGC 6 cut(s) 71, 105, 121, 155, 202, 236
BcoDI GTCTC 1 cut(s) 221
BfaI CTAG 2 cut(s) 66, 274
BmeT110I CYCGRG 1 cut(s) 221
Bsa29I ATCGAT 1 cut(s) 180
BsaWI WCCGGW 1 cut(s) 234
BsaXI ACNNNNNCTCC 2 cut(s) 135, 165
Bsc4I CCNNNNNNNGG 2 cut(s) 84, 249
Bse118I RCCGGY 1 cut(s) 128
Bse3DI GCAATG 1 cut(s) 99
BseCI ATCGAT 1 cut(s) 180
BseLI CCNNNNNNNGG 2 cut(s) 84, 249
BseMI GCAATG 1 cut(s) 99
BseMII CTCAG 1 cut(s) 170
BseRI GAGGAG 1 cut(s) 239
BshVI ATCGAT 1 cut(s) 180
BsiHKCI CYCGRG 1 cut(s) 221
BsiSI CCGG 2 cut(s) 129, 235
BslFI GGGAC 2 cut(s) 155, 266
BslI CCNNNNNNNGG 2 cut(s) 84, 249
BsmAI GTCTC 1 cut(s) 221
BsmFI GGGAC 2 cut(s) 155, 266
BsoBI CYCGRG 1 cut(s) 221
Bsp143I GATC 1 cut(s) 207
BspCNI CTCAG 1 cut(s) 169
BspDI ATCGAT 1 cut(s) 180
BsrDI GCAATG 1 cut(s) 99
BsrFI RCCGGY 1 cut(s) 128
BssAI RCCGGY 1 cut(s) 128
BssMI GATC 1 cut(s) 207
Bst4CI ACNGT 1 cut(s) 136
Bst6I CTCTTC 1 cut(s) 242
BstC8I GCNNGC 2 cut(s) 189, 215
BstDEI CTNAG 2 cut(s) 60, 156
BstKTI GATC 1 cut(s) 210
BstMAI GTCTC 1 cut(s) 221
BstMBI GATC 1 cut(s) 207
BstMWI GCNNNNNNNGC 1 cut(s) 264
Bsu15I ATCGAT 1 cut(s) 180
BsuTUI ATCGAT 1 cut(s) 180
Cac8I GCNNGC 2 cut(s) 189, 215
Cfr10I RCCGGY 1 cut(s) 128
ClaI ATCGAT 1 cut(s) 180
Csp6I GTAC 1 cut(s) 35
CviJI RGCY 4 cut(s) 14, 64, 187, 241
CviKI_1 RGCY 4 cut(s) 14, 64, 187, 241
CviQI GTAC 1 cut(s) 35
DdeI CTNAG 2 cut(s) 60, 156
DpnI GATC 1 cut(s) 209
DpnII GATC 1 cut(s) 207
Eam1104I CTCTTC 1 cut(s) 242
EarI CTCTTC 1 cut(s) 242
Eco88I CYCGRG 1 cut(s) 221
FaqI GGGAC 2 cut(s) 155, 266
FblI GTMKAC 1 cut(s) 147
FspBI CTAG 2 cut(s) 66, 274
HapII CCGG 2 cut(s) 129, 235
HinfI GANTC 1 cut(s) 144
HpaII CCGG 2 cut(s) 129, 235
Hpy166II GTNNAC 1 cut(s) 148
Hpy188I TCNGA 4 cut(s) 107, 126, 143, 159
Hpy188III TCNNGA 1 cut(s) 205
Hpy8I GTNNAC 1 cut(s) 148
Hpy99I CGWCG 2 cut(s) 155, 263
HpyAV CCTTC 3 cut(s) 88, 124, 208
HpyCH4III ACNGT 1 cut(s) 136
HpyCH4IV ACGT 2 cut(s) 150, 168
HpyCH4V TGCA 1 cut(s) 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 264
HpyF3I CTNAG 2 cut(s) 60, 156
HpySE526I ACGT 2 cut(s) 150, 168
Kzo9I GATC 1 cut(s) 207
LmnI GCTCC 1 cut(s) 264
LpnPI CCDG 3 cut(s) 142, 218, 248
MaeI CTAG 2 cut(s) 66, 274
MaeII ACGT 2 cut(s) 150, 168
MaeIII GTNAC 1 cut(s) 18
MalI GATC 1 cut(s) 209
MboI GATC 1 cut(s) 207
MboII GAAGA 1 cut(s) 259
MfeI CAATTG 1 cut(s) 70
MluCI AATT 2 cut(s) 70, 160
MlyI GAGTC 1 cut(s) 153
MmeI TCCRAC 1 cut(s) 121
MnlI CCTC 5 cut(s) 212, 217, 230, 243, 262
MspI CCGG 2 cut(s) 129, 235
MunI CAATTG 1 cut(s) 70
MwoI GCNNNNNNNGC 1 cut(s) 264
NdeII GATC 1 cut(s) 207
NmuCI GTSAC 1 cut(s) 18
PaeR7I CTCGAG 1 cut(s) 221
PcsI WCGNNNNNNNCGW 1 cut(s) 147
PleI GAGTC 1 cut(s) 152
PpsI GAGTC 1 cut(s) 152
PspXI VCTCGAGB 1 cut(s) 221
RsaI GTAC 1 cut(s) 36
RsaNI GTAC 1 cut(s) 35
Sau3AI GATC 1 cut(s) 207
SchI GAGTC 1 cut(s) 153
SetI ASST 7 cut(s) 116, 153, 171, 189, 200, 222, 273
Sfr274I CTCGAG 1 cut(s) 221
SlaI CTCGAG 1 cut(s) 221
SmlI CTYRAG 1 cut(s) 221
SmoI CTYRAG 1 cut(s) 221
Sse9I AATT 2 cut(s) 70, 160
SspMI CTAG 2 cut(s) 66, 274
TaaI ACNGT 1 cut(s) 136
TaiI ACGT 2 cut(s) 153, 171
TaqI TCGA 4 cut(s) 31, 81, 180, 222
TasI AATT 2 cut(s) 70, 160
TseFI GTSAC 1 cut(s) 18
Tsp45I GTSAC 1 cut(s) 18
XhoI CTCGAG 1 cut(s) 221
XmiI GTMKAC 1 cut(s) 147
XspI CTAG 2 cut(s) 66, 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.