Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr4

Orthogroup ID

OG0005488

Physical Location & Seq

Genomic Coordinates Forward (+)

18265669 .. 18266285

Gene Structure 617 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom04g15360.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 372 bp

ATGGCTAGCTCTGGACAGCTCCTTAAGCTTGCATGCTTGGTAGTGGTGATGCTCTGCATGGTCGCTGGTGCCCCCAAAGCCGAGGCAGCTGTGACATGCGGTCAGGTGGTGAACAGCCTGGTTCCATGCATTTCCTATGTGGGGAACGGCGGGGCATTGGACCCCGCTTGCTGCAACGGGGTGAGGACCCTCTACAACCTGGCTCAAACCACCCCTGACCGCCAGAACGTCTGCAACTGCTTGAAGCAAGCAATCAATGGAATACCTTACACCAATACCAACGCTGGCCTTGCTGCTGGCCTTCCTGCCAAGTGTGGTGTCAACATTCCGTACAAGATCAGCCCCTCTACTGACTGCAAAAGTGTGAAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0006810 GO:0006869 GO:0008150 GO:0010876 GO:0016020 GO:0033036 GO:0051179 GO:0051234 GO:0071702

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LTP_2 Tryp_alpha_amyl

Protein Analysis

124

Amino Acids

12.56

Weight (kDa)

8.72

Isoelectric Point (pI)

28.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005488)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G01870
fragaria_vesca	FvH4_6g09960 FvH4_7g28420
malus_domestica	MD04G1174000.v1.1 MD12G1187600.v1.1
prunus_persica	Prupe.6G293000_v2.0.a1
pyrus_communis	pycom04g15360 pycom12g17560
rosa_chinensis	RchiOBHm_Chr3g0460541 RchiOBHm_Chr3g0460571
rosa_laevigata	RLG00000024995 RLG00000031904
rosa_multiflora	Rmu_co8040472.1_g000001 Rmu_sc0001256.1_g000003 Rmu_sc0003701.1_g000004 Rmu_sc0006046.1_g000007
rosa_roxburghii	Rroxscaffold_6G00419360 Rroxscaffold_6G00419390
rosa_rugosa	Rorug03G0043600 Rorug03G0043900
rosa_samantha	Rh3AG101600 Rh3AG102100 Rh3BG105600 Rh3BG105800 Rh3CG107400 Rh3DG107000 Rh3DG107200
rosa_wichuraiana	Rw3G008650 Rw3G008670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	68
AciI	CCGC	4 cut(s)	99, 150, 165, 220
AfaI	GTAC	1 cut(s)	332
AfiI	CCNNNNNNNGG	1 cut(s)	141
AflII	CTTAAG	1 cut(s)	23
AgsI	TTSAA	1 cut(s)	244
AhdI	GACNNNNNGTC	1 cut(s)	99
AjnI	CCWGG	2 cut(s)	117, 198
AluBI	AGCT	4 cut(s)	9, 19, 28, 89
AluI	AGCT	4 cut(s)	9, 19, 28, 89
AoxI	GGCC	2 cut(s)	286, 298
ApeKI	GCWGC	3 cut(s)	86, 171, 293
AspS9I	GGNCC	2 cut(s)	160, 186
AsuHPI	GGTGA	3 cut(s)	58, 121, 193
AsuNHI	GCTAGC	1 cut(s)	5
AvaII	GGWCC	2 cut(s)	160, 186
BaeGI	GKGCMC	1 cut(s)	73
BanI	GGYRCC	1 cut(s)	68
BbvI	GCAGC	3 cut(s)	98, 158, 280
BceAI	ACGGC	1 cut(s)	163
BciT130I	CCWGG	2 cut(s)	119, 200
BfaI	CTAG	1 cut(s)	6
BfrI	CTTAAG	1 cut(s)	23
BisI	GCNGC	3 cut(s)	87, 172, 294
BlsI	GCNGC	3 cut(s)	88, 173, 295
Bme1390I	CCNGG	2 cut(s)	119, 200
Bme18I	GGWCC	2 cut(s)	160, 186
BmeRI	GACNNNNNGTC	1 cut(s)	99
BmgT120I	GGNCC	2 cut(s)	160, 186
BmiI	GGNNCC	4 cut(s)	70, 123, 162, 188
BmrFI	CCNGG	2 cut(s)	119, 200
BmsI	GCATC	1 cut(s)	39
BmtI	GCTAGC	1 cut(s)	9
BsaJI	CCNNGG	1 cut(s)	81
Bsc4I	CCNNNNNNNGG	1 cut(s)	141
BseBI	CCWGG	2 cut(s)	119, 200
BseDI	CCNNGG	1 cut(s)	81
BseLI	CCNNNNNNNGG	1 cut(s)	141
BseSI	GKGCMC	1 cut(s)	73
BseXI	GCAGC	3 cut(s)	98, 158, 280
BshFI	GGCC	2 cut(s)	288, 300
BshNI	GGYRCC	1 cut(s)	68
BslI	CCNNNNNNNGG	1 cut(s)	141
BsnI	GGCC	2 cut(s)	288, 300
Bsp1286I	GDGCHC	1 cut(s)	73
Bsp143I	GATC	1 cut(s)	336
BspACI	CCGC	4 cut(s)	99, 150, 165, 220
BspANI	GGCC	2 cut(s)	288, 300
BspLI	GGNNCC	4 cut(s)	70, 123, 162, 188
BspOI	GCTAGC	1 cut(s)	9
BspT107I	GGYRCC	1 cut(s)	68
BspTI	CTTAAG	1 cut(s)	23
BssECI	CCNNGG	1 cut(s)	81
BssMI	GATC	1 cut(s)	336
Bst2UI	CCWGG	2 cut(s)	119, 200
BstAFI	CTTAAG	1 cut(s)	23
BstC8I	GCNNGC	7 cut(s)	7, 30, 34, 169, 249, 286, 298
BstKTI	GATC	1 cut(s)	339
BstMBI	GATC	1 cut(s)	336
BstMWI	GCNNNNNNNGC	4 cut(s)	25, 77, 86, 290
BstNI	CCWGG	2 cut(s)	119, 200
BstNSI	RCATGY	2 cut(s)	36, 99
BstSCI	CCNGG	2 cut(s)	117, 198
BstSLI	GKGCMC	1 cut(s)	73
BstV1I	GCAGC	3 cut(s)	98, 158, 280
BsuRI	GGCC	2 cut(s)	288, 300
Cac8I	GCNNGC	7 cut(s)	7, 30, 34, 169, 249, 286, 298
Cfr13I	GGNCC	2 cut(s)	160, 186
Csp6I	GTAC	1 cut(s)	331
CviAII	CATG	4 cut(s)	33, 58, 96, 126
CviQI	GTAC	1 cut(s)	331
DpnI	GATC	1 cut(s)	338
DpnII	GATC	1 cut(s)	336
DriI	GACNNNNNGTC	1 cut(s)	99
Eam1105I	GACNNNNNGTC	1 cut(s)	99
Eco47I	GGWCC	2 cut(s)	160, 186
EcoO109I	RGGNCCY	1 cut(s)	186
EcoRII	CCWGG	2 cut(s)	117, 198
EcoT22I	ATGCAT	1 cut(s)	131
FaeI	CATG	4 cut(s)	36, 61, 99, 129
FaiI	YATR	5 cut(s)	34, 59, 97, 127, 138
FatI	CATG	4 cut(s)	32, 57, 95, 125
FauI	CCCGC	2 cut(s)	143, 172
Fnu4HI	GCNGC	3 cut(s)	87, 172, 294
Fsp4HI	GCNGC	3 cut(s)	87, 172, 294
FspBI	CTAG	1 cut(s)	6
GluI	GCNGC	3 cut(s)	87, 172, 294
HaeIII	GGCC	2 cut(s)	288, 300
Hin1II	CATG	4 cut(s)	36, 61, 99, 129
HincII	GTYRAC	1 cut(s)	322
HindII	GTYRAC	1 cut(s)	322
HindIII	AAGCTT	1 cut(s)	26
HphI	GGTGA	3 cut(s)	58, 121, 193
Hpy166II	GTNNAC	2 cut(s)	112, 322
Hpy188III	TCNNGA	1 cut(s)	12
Hpy8I	GTNNAC	2 cut(s)	112, 322
HpyAV	CCTTC	1 cut(s)	311
HpyCH4IV	ACGT	1 cut(s)	228
HpyCH4V	TGCA	6 cut(s)	32, 57, 129, 174, 234, 357
HpyF10VI	GCNNNNNNNGC	4 cut(s)	25, 77, 86, 290
HpySE526I	ACGT	1 cut(s)	228
Hsp92II	CATG	4 cut(s)	36, 61, 99, 129
Kzo9I	GATC	1 cut(s)	336
LmnI	GCTCC	1 cut(s)	24
Lsp1109I	GCAGC	3 cut(s)	98, 158, 280
LweI	GCATC	1 cut(s)	39
MaeI	CTAG	1 cut(s)	6
MaeII	ACGT	1 cut(s)	228
MaeIII	GTNAC	1 cut(s)	91
MalI	GATC	1 cut(s)	338
MboI	GATC	1 cut(s)	336
MhlI	GDGCHC	1 cut(s)	73
MnlI	CCTC	4 cut(s)	76, 177, 200, 355
Mph1103I	ATGCAT	1 cut(s)	131
MseI	TTAA	1 cut(s)	24
MspA1I	CMGCKG	1 cut(s)	89
MspCI	CTTAAG	1 cut(s)	23
MspR9I	CCNGG	2 cut(s)	119, 200
MvaI	CCWGG	2 cut(s)	119, 200
MwoI	GCNNNNNNNGC	4 cut(s)	25, 77, 86, 290
NdeII	GATC	1 cut(s)	336
NheI	GCTAGC	1 cut(s)	5
NlaIII	CATG	4 cut(s)	36, 61, 99, 129
NlaIV	GGNNCC	4 cut(s)	70, 123, 162, 188
NmeAIII	GCCGAG	1 cut(s)	106
NmuCI	GTSAC	1 cut(s)	91
NsiI	ATGCAT	1 cut(s)	131
NspI	RCATGY	2 cut(s)	36, 99
PaeI	GCATGC	1 cut(s)	36
PkrI	GCNGC	3 cut(s)	88, 173, 295
PpuMI	RGGWCCY	1 cut(s)	186
Psp5II	RGGWCCY	1 cut(s)	186
Psp6I	CCWGG	2 cut(s)	117, 198
PspGI	CCWGG	2 cut(s)	117, 198
PspN4I	GGNNCC	4 cut(s)	70, 123, 162, 188
PspPI	GGNCC	2 cut(s)	160, 186
PspPPI	RGGWCCY	1 cut(s)	186
PvuII	CAGCTG	1 cut(s)	89
RsaI	GTAC	1 cut(s)	332
RsaNI	GTAC	1 cut(s)	331
SaqAI	TTAA	1 cut(s)	24
SatI	GCNGC	3 cut(s)	87, 172, 294
Sau3AI	GATC	1 cut(s)	336
Sau96I	GGNCC	2 cut(s)	160, 186
ScrFI	CCNGG	2 cut(s)	119, 200
SduI	GDGCHC	1 cut(s)	73
SetI	ASST	8 cut(s)	11, 21, 30, 91, 108, 201, 231, 268
SfaNI	GCATC	1 cut(s)	39
SinI	GGWCC	2 cut(s)	160, 186
SmlI	CTYRAG	1 cut(s)	23
SmoI	CTYRAG	1 cut(s)	23
SphI	GCATGC	1 cut(s)	36
SsiI	CCGC	4 cut(s)	99, 150, 165, 220
SspMI	CTAG	1 cut(s)	6
StyD4I	CCNGG	2 cut(s)	117, 198
TaiI	ACGT	1 cut(s)	231
Tru1I	TTAA	1 cut(s)	24
Tru9I	TTAA	1 cut(s)	24
TseFI	GTSAC	1 cut(s)	91
TseI	GCWGC	3 cut(s)	86, 171, 293
Tsp45I	GTSAC	1 cut(s)	91
TspGWI	ACGGA	1 cut(s)	318
Vha464I	CTTAAG	1 cut(s)	23
VpaK11BI	GGWCC	2 cut(s)	160, 186
XceI	RCATGY	2 cut(s)	36, 99
XspI	CTAG	1 cut(s)	6
Zsp2I	ATGCAT	1 cut(s)	131

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.