Rmu_co8040472.1_g000001

Plant non-specific lipid-transfer proteins transfer phospholipids as well as galactolipids across membranes. May play a role in wax or cutin deposition in the cell walls of expanding epidermal cells and certain secretory tissues

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8040472.1
Physical Location & Seq
Forward (+)
25 .. 499
475 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8040472.1_g000001.1.cds

Sequence Viewer

Length: 366 bp
atggcgttctctagagttctgaaggtgatttgcttggtggtgctatccgtggctgcactgtggtttggtgatgcgaaagcagccattacgtgcggtcaggtggtgaataagctgatgccatgcgttgcctacgtccaaaacggtgggactcccgcggtgggttgctgtagcgggatcaagaccctctacggcatggctcaaaccacccctgaccgccagagcgtgtgcaactgtttgaaacaagcagttgccggaattccgtacaccggagctaacgccggtcttgctgctggccttcccggcaagtgtggtgtcaaccttccctacaagatcaacccttctactgactgcaaaagcatcaagtga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

121

Amino Acids

12.43

Weight (kDa)

9.17

Isoelectric Point (pI)

22.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 155
AciI CCGC 5 cut(s) 93, 153, 155, 171, 214
AclWI GGATC 1 cut(s) 182
AcsI RAATTY 1 cut(s) 255
AcuI CTGAAG 1 cut(s) 41
AfaI GTAC 1 cut(s) 263
AfiI CCNNNNNNNGG 2 cut(s) 158, 266
AgsI TTSAA 1 cut(s) 238
AluBI AGCT 2 cut(s) 112, 272
AluI AGCT 2 cut(s) 112, 272
AlwI GGATC 1 cut(s) 182
AoxI GGCC 1 cut(s) 292
ApeKI GCWGC 3 cut(s) 53, 80, 287
ApoI RAATTY 1 cut(s) 255
AsuC2I CCSGG 1 cut(s) 300
AsuHPI GGTGA 3 cut(s) 37, 80, 115
BbvI GCAGC 3 cut(s) 40, 92, 274
BceAI ACGGC 1 cut(s) 205
BcnI CCSGG 1 cut(s) 300
BfaI CTAG 1 cut(s) 12
BfmI CTRYAG 1 cut(s) 166
BglI GCCNNNNNGGC 1 cut(s) 300
BisI GCNGC 3 cut(s) 54, 81, 288
BlsI GCNGC 3 cut(s) 55, 82, 289
Bme1390I CCNGG 1 cut(s) 300
BmrFI CCNGG 1 cut(s) 300
BmsI GCATC 2 cut(s) 61, 105
BpuMI CCSGG 1 cut(s) 300
BsaAI YACGTR 1 cut(s) 90
BsaJI CCNNGG 2 cut(s) 48, 153
BsaWI WCCGGW 1 cut(s) 266
Bsc4I CCNNNNNNNGG 2 cut(s) 158, 266
Bse118I RCCGGY 1 cut(s) 278
BseDI CCNNGG 2 cut(s) 48, 153
BseLI CCNNNNNNNGG 2 cut(s) 158, 266
BseXI GCAGC 3 cut(s) 40, 92, 274
BsgI GTGCAG 1 cut(s) 39
Bsh1236I CGCG 1 cut(s) 155
BshFI GGCC 1 cut(s) 294
BsiSI CCGG 4 cut(s) 252, 267, 279, 300
BslFI GGGAC 1 cut(s) 160
BslI CCNNNNNNNGG 2 cut(s) 158, 266
BsmFI GGGAC 1 cut(s) 160
BsnI GGCC 1 cut(s) 294
Bsp143I GATC 2 cut(s) 174, 330
BspACI CCGC 5 cut(s) 93, 153, 155, 171, 214
BspANI GGCC 1 cut(s) 294
BspFNI CGCG 1 cut(s) 155
BspPI GGATC 1 cut(s) 182
BsrFI RCCGGY 1 cut(s) 278
BssAI RCCGGY 1 cut(s) 278
BssECI CCNNGG 2 cut(s) 48, 153
BssMI GATC 2 cut(s) 174, 330
Bst4CI ACNGT 3 cut(s) 60, 143, 233
BstBAI YACGTR 1 cut(s) 90
BstC8I GCNNGC 1 cut(s) 292
BstDSI CCRYGG 2 cut(s) 48, 153
BstFNI CGCG 1 cut(s) 155
BstKTI GATC 2 cut(s) 177, 333
BstMBI GATC 2 cut(s) 174, 330
BstMWI GCNNNNNNNGC 3 cut(s) 80, 284, 300
BstSCI CCNGG 1 cut(s) 298
BstSFI CTRYAG 1 cut(s) 166
BstUI CGCG 1 cut(s) 155
BstV1I GCAGC 3 cut(s) 40, 92, 274
BstXI CCANNNNNNTGG 1 cut(s) 143
BsuRI GGCC 1 cut(s) 294
BtgI CCRYGG 2 cut(s) 48, 153
BtsIMutI CAGTG 1 cut(s) 56
Cac8I GCNNGC 1 cut(s) 292
Cfr10I RCCGGY 1 cut(s) 278
Cfr42I CCGCGG 1 cut(s) 156
Csp6I GTAC 1 cut(s) 262
CviAII CATG 2 cut(s) 120, 193
CviJI RGCY 6 cut(s) 53, 83, 112, 197, 272, 294
CviKI_1 RGCY 6 cut(s) 53, 83, 112, 197, 272, 294
CviQI GTAC 1 cut(s) 262
DpnI GATC 2 cut(s) 176, 332
DpnII GATC 2 cut(s) 174, 330
Eco57I CTGAAG 1 cut(s) 41
EcoRI GAATTC 1 cut(s) 255
FaeI CATG 2 cut(s) 123, 196
FaiI YATR 2 cut(s) 121, 194
FaqI GGGAC 1 cut(s) 160
FatI CATG 2 cut(s) 119, 192
FauI CCCGC 2 cut(s) 160, 164
Fnu4HI GCNGC 3 cut(s) 54, 81, 288
Fsp4HI GCNGC 3 cut(s) 54, 81, 288
FspBI CTAG 1 cut(s) 12
GluI GCNGC 3 cut(s) 54, 81, 288
HaeIII GGCC 1 cut(s) 294
HapII CCGG 4 cut(s) 252, 267, 279, 300
Hin1II CATG 2 cut(s) 123, 196
HincII GTYRAC 1 cut(s) 316
HindII GTYRAC 1 cut(s) 316
HinfI GANTC 1 cut(s) 148
HpaII CCGG 4 cut(s) 252, 267, 279, 300
HphI GGTGA 3 cut(s) 37, 80, 115
Hpy166II GTNNAC 2 cut(s) 264, 316
Hpy188I TCNGA 1 cut(s) 21
Hpy188III TCNNGA 2 cut(s) 12, 178
Hpy8I GTNNAC 2 cut(s) 264, 316
HpyAV CCTTC 4 cut(s) 16, 305, 329, 348
HpyCH4III ACNGT 3 cut(s) 60, 143, 233
HpyCH4IV ACGT 2 cut(s) 89, 132
HpyCH4V TGCA 3 cut(s) 56, 228, 351
HpyF10VI GCNNNNNNNGC 3 cut(s) 80, 284, 300
HpySE526I ACGT 2 cut(s) 89, 132
Hsp92II CATG 2 cut(s) 123, 196
KspI CCGCGG 1 cut(s) 156
Kzo9I GATC 2 cut(s) 174, 330
LmnI GCTCC 1 cut(s) 269
LpnPI CCDG 8 cut(s) 83, 222, 230, 265, 276, 280, 292, 313
Lsp1109I GCAGC 3 cut(s) 40, 92, 274
LweI GCATC 2 cut(s) 61, 105
MaeI CTAG 1 cut(s) 12
MaeII ACGT 2 cut(s) 89, 132
MalI GATC 2 cut(s) 176, 332
MboI GATC 2 cut(s) 174, 330
MluCI AATT 1 cut(s) 255
MlyI GAGTC 1 cut(s) 142
MnlI CCTC 1 cut(s) 194
MspA1I CMGCKG 1 cut(s) 155
MspI CCGG 4 cut(s) 252, 267, 279, 300
MspR9I CCNGG 1 cut(s) 300
MvnI CGCG 1 cut(s) 155
MwoI GCNNNNNNNGC 3 cut(s) 80, 284, 300
NciI CCSGG 1 cut(s) 300
NdeII GATC 2 cut(s) 174, 330
NlaIII CATG 2 cut(s) 123, 196
PkrI GCNGC 3 cut(s) 55, 82, 289
PleI GAGTC 1 cut(s) 142
PpsI GAGTC 1 cut(s) 142
Ppu21I YACGTR 1 cut(s) 90
RsaI GTAC 1 cut(s) 263
RsaNI GTAC 1 cut(s) 262
SacII CCGCGG 1 cut(s) 156
SatI GCNGC 3 cut(s) 54, 81, 288
Sau3AI GATC 2 cut(s) 174, 330
SchI GAGTC 1 cut(s) 142
ScrFI CCNGG 1 cut(s) 300
SetI ASST 7 cut(s) 27, 92, 102, 114, 135, 274, 321
SfaNI GCATC 2 cut(s) 61, 105
SfcI CTRYAG 1 cut(s) 166
Sfr303I CCGCGG 1 cut(s) 156
SgrBI CCGCGG 1 cut(s) 156
Sse9I AATT 1 cut(s) 255
SsiI CCGC 5 cut(s) 93, 153, 155, 171, 214
SspMI CTAG 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 298
TaaI ACNGT 3 cut(s) 60, 143, 233
TaiI ACGT 2 cut(s) 92, 135
TasI AATT 1 cut(s) 255
TscAI CASTG 1 cut(s) 63
TseI GCWGC 3 cut(s) 53, 80, 287
TspGWI ACGGA 2 cut(s) 37, 249
TspRI CASTG 1 cut(s) 63
XapI RAATTY 1 cut(s) 255
XbaI TCTAGA 1 cut(s) 11
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.