Rmu_sc0003701.1_g000004

Plant non-specific lipid-transfer proteins transfer phospholipids as well as galactolipids across membranes. May play a role in wax or cutin deposition in the cell walls of expanding epidermal cells and certain secretory tissues

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003701.1
Physical Location & Seq
Reverse (-)
9865 .. 10293
429 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003701.1_g000004.1.cds

Sequence Viewer

Length: 429 bp
atggcttgctctagggcttttattctactctgcgtggtggtggtgtccatggcggcactgttgttgggcggagccaaagcaaccataacctgcagtcaggtggtgaacgggctgacaccgtgcattccctacttggaaaaaggtgggacacctgcctcaggttgctgcagcgggatcaagaccctctacagcacggcacacaccaccgctgacctccagggcgtttgtaactgtttgaaagaaaaattcagcagtattcactacagcagcaataacgtccgctttgctgctgggcttcctgccaagtgcgggatcaaaattccgtacaagatcagcccctccaccaactgcaaaaggtatgtaaagaaacacgaaacagaatctccatattatgtttataaactgtacgtacctgcatgcatatcttag
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

142

Amino Acids

15.17

Weight (kDa)

9.15

Isoelectric Point (pI)

40.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 399
AarI CACCTGC 1 cut(s) 160
Acc36I ACCTGC 3 cut(s) 98, 160, 421
AciI CCGC 6 cut(s) 53, 69, 171, 207, 280, 309
AclWI GGATC 2 cut(s) 182, 320
AcsI RAATTY 2 cut(s) 245, 318
AfaI GTAC 3 cut(s) 326, 407, 411
AfiI CCNNNNNNNGG 2 cut(s) 158, 309
AgsI TTSAA 1 cut(s) 238
AjnI CCWGG 1 cut(s) 216
AlwI GGATC 2 cut(s) 182, 320
ApeKI GCWGC 4 cut(s) 165, 168, 267, 287
ApoI RAATTY 2 cut(s) 245, 318
AsuHPI GGTGA 1 cut(s) 115
AxyI CCTNAGG 1 cut(s) 157
BbvI GCAGC 4 cut(s) 152, 180, 274, 279
BceAI ACGGC 1 cut(s) 210
BciT130I CCWGG 1 cut(s) 218
BfaI CTAG 1 cut(s) 12
BfmI CTRYAG 4 cut(s) 91, 166, 187, 262
BfuAI ACCTGC 3 cut(s) 98, 160, 421
BisI GCNGC 5 cut(s) 54, 166, 169, 268, 288
BlsI GCNGC 5 cut(s) 55, 167, 170, 269, 289
Bme1390I CCNGG 1 cut(s) 218
BmiI GGNNCC 1 cut(s) 73
BmrFI CCNGG 1 cut(s) 218
BpmI CTGGAG 1 cut(s) 200
BsaAI YACGTR 1 cut(s) 409
BsaJI CCNNGG 2 cut(s) 48, 217
BsaXI ACNNNNNCTCC 2 cut(s) 367, 397
Bsc4I CCNNNNNNNGG 2 cut(s) 158, 309
Bse21I CCTNAGG 1 cut(s) 157
BseBI CCWGG 1 cut(s) 218
BseDI CCNNGG 2 cut(s) 48, 217
BseLI CCNNNNNNNGG 2 cut(s) 158, 309
BseMII CTCAG 1 cut(s) 171
BseXI GCAGC 4 cut(s) 152, 180, 274, 279
BseYI CCCAGC 1 cut(s) 290
BslFI GGGAC 1 cut(s) 160
BslI CCNNNNNNNGG 2 cut(s) 158, 309
BsmFI GGGAC 1 cut(s) 160
BsmI GAATGC 1 cut(s) 123
Bsp143I GATC 3 cut(s) 174, 312, 330
Bsp19I CCATGG 1 cut(s) 48
BspACI CCGC 6 cut(s) 53, 69, 171, 207, 280, 309
BspCNI CTCAG 1 cut(s) 170
BspLI GGNNCC 1 cut(s) 73
BspMAI CTGCAG 2 cut(s) 95, 170
BspMI ACCTGC 3 cut(s) 98, 160, 421
BspPI GGATC 2 cut(s) 182, 320
BssECI CCNNGG 2 cut(s) 48, 217
BssMI GATC 3 cut(s) 174, 312, 330
BssT1I CCWWGG 1 cut(s) 48
Bst2UI CCWGG 1 cut(s) 218
Bst4CI ACNGT 4 cut(s) 60, 120, 233, 405
BstBAI YACGTR 1 cut(s) 409
BstC8I GCNNGC 2 cut(s) 7, 418
BstDEI CTNAG 2 cut(s) 157, 426
BstDSI CCRYGG 1 cut(s) 48
BstENI CCTNNNNNAGG 1 cut(s) 156
BstKTI GATC 3 cut(s) 177, 315, 333
BstMBI GATC 3 cut(s) 174, 312, 330
BstNI CCWGG 1 cut(s) 218
BstNSI RCATGY 1 cut(s) 420
BstSCI CCNGG 1 cut(s) 216
BstSFI CTRYAG 4 cut(s) 91, 166, 187, 262
BstSNI TACGTA 1 cut(s) 409
BstV1I GCAGC 4 cut(s) 152, 180, 274, 279
Bsu36I CCTNAGG 1 cut(s) 157
BtgI CCRYGG 1 cut(s) 48
BtsIMutI CAGTG 1 cut(s) 56
BveI ACCTGC 3 cut(s) 98, 160, 421
Cac8I GCNNGC 2 cut(s) 7, 418
Csp6I GTAC 3 cut(s) 325, 406, 410
CviAII CATG 2 cut(s) 49, 417
CviJI RGCY 6 cut(s) 5, 17, 74, 112, 295, 336
CviKI_1 RGCY 6 cut(s) 5, 17, 74, 112, 295, 336
CviQI GTAC 3 cut(s) 325, 406, 410
DdeI CTNAG 2 cut(s) 157, 426
DpnI GATC 3 cut(s) 176, 314, 332
DpnII GATC 3 cut(s) 174, 312, 330
EciI GGCGGA 1 cut(s) 84
Eco105I TACGTA 1 cut(s) 409
Eco130I CCWWGG 1 cut(s) 48
Eco81I CCTNAGG 1 cut(s) 157
EcoNI CCTNNNNNAGG 1 cut(s) 156
EcoRII CCWGG 1 cut(s) 216
EcoT14I CCWWGG 1 cut(s) 48
EcoT22I ATGCAT 1 cut(s) 422
ErhI CCWWGG 1 cut(s) 48
FaeI CATG 2 cut(s) 52, 420
FaiI YATR 8 cut(s) 50, 86, 360, 388, 393, 399, 418, 422
FaqI GGGAC 1 cut(s) 160
FatI CATG 2 cut(s) 48, 416
FauI CCCGC 2 cut(s) 164, 302
Fnu4HI GCNGC 5 cut(s) 54, 166, 169, 268, 288
Fsp4HI GCNGC 5 cut(s) 54, 166, 169, 268, 288
FspBI CTAG 1 cut(s) 12
GluI GCNGC 5 cut(s) 54, 166, 169, 268, 288
GsaI CCCAGC 1 cut(s) 294
GsuI CTGGAG 1 cut(s) 200
Hin1II CATG 2 cut(s) 52, 420
HinfI GANTC 1 cut(s) 380
HphI GGTGA 1 cut(s) 115
Hpy166II GTNNAC 1 cut(s) 106
Hpy188III TCNNGA 1 cut(s) 178
Hpy8I GTNNAC 1 cut(s) 106
HpyCH4III ACNGT 4 cut(s) 60, 120, 233, 405
HpyCH4IV ACGT 2 cut(s) 276, 408
HpyCH4V TGCA 6 cut(s) 93, 123, 168, 351, 416, 420
HpyF3I CTNAG 2 cut(s) 157, 426
HpySE526I ACGT 2 cut(s) 276, 408
Hsp92II CATG 2 cut(s) 52, 420
Kzo9I GATC 3 cut(s) 174, 312, 330
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 8 cut(s) 83, 103, 144, 165, 203, 230, 276, 312
Lsp1109I GCAGC 4 cut(s) 152, 180, 274, 279
MaeI CTAG 1 cut(s) 12
MaeII ACGT 2 cut(s) 276, 408
MaeIII GTNAC 1 cut(s) 227
MalI GATC 3 cut(s) 176, 314, 332
MboI GATC 3 cut(s) 174, 312, 330
MluCI AATT 2 cut(s) 245, 318
MnlI CCTC 4 cut(s) 166, 194, 224, 349
Mph1103I ATGCAT 1 cut(s) 422
MspA1I CMGCKG 2 cut(s) 171, 209
MspR9I CCNGG 1 cut(s) 218
Mva1269I GAATGC 1 cut(s) 123
MvaI CCWGG 1 cut(s) 218
NcoI CCATGG 1 cut(s) 48
NdeII GATC 3 cut(s) 174, 312, 330
NlaIII CATG 2 cut(s) 52, 420
NlaIV GGNNCC 1 cut(s) 73
NsiI ATGCAT 1 cut(s) 422
NspI RCATGY 1 cut(s) 420
PaeI GCATGC 1 cut(s) 420
PaqCI CACCTGC 1 cut(s) 160
PctI GAATGC 1 cut(s) 123
PfeI GAWTC 1 cut(s) 380
PkrI GCNGC 5 cut(s) 55, 167, 170, 269, 289
Ppu21I YACGTR 1 cut(s) 409
PsiI TTATAA 1 cut(s) 399
Psp6I CCWGG 1 cut(s) 216
PspFI CCCAGC 1 cut(s) 290
PspGI CCWGG 1 cut(s) 216
PspN4I GGNNCC 1 cut(s) 73
PstI CTGCAG 2 cut(s) 95, 170
RsaI GTAC 3 cut(s) 326, 407, 411
RsaNI GTAC 3 cut(s) 325, 406, 410
SatI GCNGC 5 cut(s) 54, 166, 169, 268, 288
Sau3AI GATC 3 cut(s) 174, 312, 330
ScrFI CCNGG 1 cut(s) 218
SfcI CTRYAG 4 cut(s) 91, 166, 187, 262
SnaBI TACGTA 1 cut(s) 409
SphI GCATGC 1 cut(s) 420
Sse9I AATT 2 cut(s) 245, 318
SsiI CCGC 6 cut(s) 53, 69, 171, 207, 280, 309
SspMI CTAG 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 216
StyI CCWWGG 1 cut(s) 48
TaaI ACNGT 4 cut(s) 60, 120, 233, 405
TaiI ACGT 2 cut(s) 279, 411
TasI AATT 2 cut(s) 245, 318
TauI GCSGC 1 cut(s) 56
TfiI GAWTC 1 cut(s) 380
TscAI CASTG 1 cut(s) 63
TseI GCWGC 4 cut(s) 165, 168, 267, 287
TspGWI ACGGA 1 cut(s) 312
TspRI CASTG 1 cut(s) 63
XagI CCTNNNNNAGG 1 cut(s) 156
XapI RAATTY 2 cut(s) 245, 318
XceI RCATGY 1 cut(s) 420
XspI CTAG 1 cut(s) 12
Zsp2I ATGCAT 1 cut(s) 422
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.