pycom04g15360

Plant non-specific lipid-transfer proteins transfer phospholipids as well as galactolipids across membranes. May play a role in wax or cutin deposition in the cell walls of expanding epidermal cells and certain secretory tissues

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0005488
Physical Location & Seq
Forward (+)
18265669 .. 18266285
617 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 372 bp
ATGGCTAGCTCTGGACAGCTCCTTAAGCTTGCATGCTTGGTAGTGGTGATGCTCTGCATGGTCGCTGGTGCCCCCAAAGCCGAGGCAGCTGTGACATGCGGTCAGGTGGTGAACAGCCTGGTTCCATGCATTTCCTATGTGGGGAACGGCGGGGCATTGGACCCCGCTTGCTGCAACGGGGTGAGGACCCTCTACAACCTGGCTCAAACCACCCCTGACCGCCAGAACGTCTGCAACTGCTTGAAGCAAGCAATCAATGGAATACCTTACACCAATACCAACGCTGGCCTTGCTGCTGGCCTTCCTGCCAAGTGTGGTGTCAACATTCCGTACAAGATCAGCCCCTCTACTGACTGCAAAAGTGTGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0006810 GO:0006869 GO:0008150 GO:0010876 GO:0016020 GO:0033036 GO:0051179 GO:0051234 GO:0071702
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LTP_2 Tryp_alpha_amyl

Protein Analysis

124

Amino Acids

12.56

Weight (kDa)

8.72

Isoelectric Point (pI)

28.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tryp_alpha_amyl PF00234 33 - 119 8.8e-15 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 68
AciI CCGC 4 cut(s) 99, 150, 165, 220
AfaI GTAC 1 cut(s) 332
AfiI CCNNNNNNNGG 1 cut(s) 141
AflII CTTAAG 1 cut(s) 23
AgsI TTSAA 1 cut(s) 244
AhdI GACNNNNNGTC 1 cut(s) 99
AjnI CCWGG 2 cut(s) 117, 198
AluBI AGCT 4 cut(s) 9, 19, 28, 89
AluI AGCT 4 cut(s) 9, 19, 28, 89
AoxI GGCC 2 cut(s) 286, 298
ApeKI GCWGC 3 cut(s) 86, 171, 293
AspS9I GGNCC 2 cut(s) 160, 186
AsuHPI GGTGA 3 cut(s) 58, 121, 193
AsuNHI GCTAGC 1 cut(s) 5
AvaII GGWCC 2 cut(s) 160, 186
BaeGI GKGCMC 1 cut(s) 73
BanI GGYRCC 1 cut(s) 68
BbvI GCAGC 3 cut(s) 98, 158, 280
BceAI ACGGC 1 cut(s) 163
BciT130I CCWGG 2 cut(s) 119, 200
BfaI CTAG 1 cut(s) 6
BfrI CTTAAG 1 cut(s) 23
BisI GCNGC 3 cut(s) 87, 172, 294
BlsI GCNGC 3 cut(s) 88, 173, 295
Bme1390I CCNGG 2 cut(s) 119, 200
Bme18I GGWCC 2 cut(s) 160, 186
BmeRI GACNNNNNGTC 1 cut(s) 99
BmgT120I GGNCC 2 cut(s) 160, 186
BmiI GGNNCC 4 cut(s) 70, 123, 162, 188
BmrFI CCNGG 2 cut(s) 119, 200
BmsI GCATC 1 cut(s) 39
BmtI GCTAGC 1 cut(s) 9
BsaJI CCNNGG 1 cut(s) 81
Bsc4I CCNNNNNNNGG 1 cut(s) 141
BseBI CCWGG 2 cut(s) 119, 200
BseDI CCNNGG 1 cut(s) 81
BseLI CCNNNNNNNGG 1 cut(s) 141
BseSI GKGCMC 1 cut(s) 73
BseXI GCAGC 3 cut(s) 98, 158, 280
BshFI GGCC 2 cut(s) 288, 300
BshNI GGYRCC 1 cut(s) 68
BslI CCNNNNNNNGG 1 cut(s) 141
BsnI GGCC 2 cut(s) 288, 300
Bsp1286I GDGCHC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 336
BspACI CCGC 4 cut(s) 99, 150, 165, 220
BspANI GGCC 2 cut(s) 288, 300
BspLI GGNNCC 4 cut(s) 70, 123, 162, 188
BspOI GCTAGC 1 cut(s) 9
BspT107I GGYRCC 1 cut(s) 68
BspTI CTTAAG 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 1 cut(s) 336
Bst2UI CCWGG 2 cut(s) 119, 200
BstAFI CTTAAG 1 cut(s) 23
BstC8I GCNNGC 7 cut(s) 7, 30, 34, 169, 249, 286, 298
BstKTI GATC 1 cut(s) 339
BstMBI GATC 1 cut(s) 336
BstMWI GCNNNNNNNGC 4 cut(s) 25, 77, 86, 290
BstNI CCWGG 2 cut(s) 119, 200
BstNSI RCATGY 2 cut(s) 36, 99
BstSCI CCNGG 2 cut(s) 117, 198
BstSLI GKGCMC 1 cut(s) 73
BstV1I GCAGC 3 cut(s) 98, 158, 280
BsuRI GGCC 2 cut(s) 288, 300
Cac8I GCNNGC 7 cut(s) 7, 30, 34, 169, 249, 286, 298
Cfr13I GGNCC 2 cut(s) 160, 186
Csp6I GTAC 1 cut(s) 331
CviAII CATG 4 cut(s) 33, 58, 96, 126
CviQI GTAC 1 cut(s) 331
DpnI GATC 1 cut(s) 338
DpnII GATC 1 cut(s) 336
DriI GACNNNNNGTC 1 cut(s) 99
Eam1105I GACNNNNNGTC 1 cut(s) 99
Eco47I GGWCC 2 cut(s) 160, 186
EcoO109I RGGNCCY 1 cut(s) 186
EcoRII CCWGG 2 cut(s) 117, 198
EcoT22I ATGCAT 1 cut(s) 131
FaeI CATG 4 cut(s) 36, 61, 99, 129
FaiI YATR 5 cut(s) 34, 59, 97, 127, 138
FatI CATG 4 cut(s) 32, 57, 95, 125
FauI CCCGC 2 cut(s) 143, 172
Fnu4HI GCNGC 3 cut(s) 87, 172, 294
Fsp4HI GCNGC 3 cut(s) 87, 172, 294
FspBI CTAG 1 cut(s) 6
GluI GCNGC 3 cut(s) 87, 172, 294
HaeIII GGCC 2 cut(s) 288, 300
Hin1II CATG 4 cut(s) 36, 61, 99, 129
HincII GTYRAC 1 cut(s) 322
HindII GTYRAC 1 cut(s) 322
HindIII AAGCTT 1 cut(s) 26
HphI GGTGA 3 cut(s) 58, 121, 193
Hpy166II GTNNAC 2 cut(s) 112, 322
Hpy188III TCNNGA 1 cut(s) 12
Hpy8I GTNNAC 2 cut(s) 112, 322
HpyAV CCTTC 1 cut(s) 311
HpyCH4IV ACGT 1 cut(s) 228
HpyCH4V TGCA 6 cut(s) 32, 57, 129, 174, 234, 357
HpyF10VI GCNNNNNNNGC 4 cut(s) 25, 77, 86, 290
HpySE526I ACGT 1 cut(s) 228
Hsp92II CATG 4 cut(s) 36, 61, 99, 129
Kzo9I GATC 1 cut(s) 336
LmnI GCTCC 1 cut(s) 24
Lsp1109I GCAGC 3 cut(s) 98, 158, 280
LweI GCATC 1 cut(s) 39
MaeI CTAG 1 cut(s) 6
MaeII ACGT 1 cut(s) 228
MaeIII GTNAC 1 cut(s) 91
MalI GATC 1 cut(s) 338
MboI GATC 1 cut(s) 336
MhlI GDGCHC 1 cut(s) 73
MnlI CCTC 4 cut(s) 76, 177, 200, 355
Mph1103I ATGCAT 1 cut(s) 131
MseI TTAA 1 cut(s) 24
MspA1I CMGCKG 1 cut(s) 89
MspCI CTTAAG 1 cut(s) 23
MspR9I CCNGG 2 cut(s) 119, 200
MvaI CCWGG 2 cut(s) 119, 200
MwoI GCNNNNNNNGC 4 cut(s) 25, 77, 86, 290
NdeII GATC 1 cut(s) 336
NheI GCTAGC 1 cut(s) 5
NlaIII CATG 4 cut(s) 36, 61, 99, 129
NlaIV GGNNCC 4 cut(s) 70, 123, 162, 188
NmeAIII GCCGAG 1 cut(s) 106
NmuCI GTSAC 1 cut(s) 91
NsiI ATGCAT 1 cut(s) 131
NspI RCATGY 2 cut(s) 36, 99
PaeI GCATGC 1 cut(s) 36
PkrI GCNGC 3 cut(s) 88, 173, 295
PpuMI RGGWCCY 1 cut(s) 186
Psp5II RGGWCCY 1 cut(s) 186
Psp6I CCWGG 2 cut(s) 117, 198
PspGI CCWGG 2 cut(s) 117, 198
PspN4I GGNNCC 4 cut(s) 70, 123, 162, 188
PspPI GGNCC 2 cut(s) 160, 186
PspPPI RGGWCCY 1 cut(s) 186
PvuII CAGCTG 1 cut(s) 89
RsaI GTAC 1 cut(s) 332
RsaNI GTAC 1 cut(s) 331
SaqAI TTAA 1 cut(s) 24
SatI GCNGC 3 cut(s) 87, 172, 294
Sau3AI GATC 1 cut(s) 336
Sau96I GGNCC 2 cut(s) 160, 186
ScrFI CCNGG 2 cut(s) 119, 200
SduI GDGCHC 1 cut(s) 73
SetI ASST 8 cut(s) 11, 21, 30, 91, 108, 201, 231, 268
SfaNI GCATC 1 cut(s) 39
SinI GGWCC 2 cut(s) 160, 186
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
SphI GCATGC 1 cut(s) 36
SsiI CCGC 4 cut(s) 99, 150, 165, 220
SspMI CTAG 1 cut(s) 6
StyD4I CCNGG 2 cut(s) 117, 198
TaiI ACGT 1 cut(s) 231
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TseFI GTSAC 1 cut(s) 91
TseI GCWGC 3 cut(s) 86, 171, 293
Tsp45I GTSAC 1 cut(s) 91
TspGWI ACGGA 1 cut(s) 318
Vha464I CTTAAG 1 cut(s) 23
VpaK11BI GGWCC 2 cut(s) 160, 186
XceI RCATGY 2 cut(s) 36, 99
XspI CTAG 1 cut(s) 6
Zsp2I ATGCAT 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.