pycom08g01020

Protein of unknown function (DUF615)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0011405
Physical Location & Seq
Reverse (-)
794958 .. 795607
650 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g01020.2

Sequence Viewer

Length: 471 bp
ATGGCTGCTCACGCGGGACGGCTTCTGAGGCAATGGCCGATGTGGCAGCAGCATTGCTGCTCAAACGCCGCCTTCCACCACCTTATCTTCTCCCCCTTACTTCCGGTCACCACCAGAACCAACTCCCGTCGTCCGTCTTTGACCACCGTCCACCTGGCCACTCGCGGCGTCCATAAACTATTTCGCGGGCTCAGACCGTCCGATTACCAGGACGCCAACACCGCCAGTTCGAATTTAGGTTCGGATTCGGATGCAGTCACGTACAAGAGCCACAACGAGTTGAAGCGCCACGCCCGACGCGCCGTCCGTTGGGCTATGGACCTCGCCTCCTTCTCCACCCCTCAAATCAAACGCATTGTCAGAGTGGCTGCTCTGGACCAAGACGTGTTGGATGCTGTGATTCTAGTGAAGAAACTAGGACCGGATGTTCGAGAAGGGAAGCGAAGGCAGTTCAATTATATTGTTATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF615

Protein Analysis

157

Amino Acids

17.74

Weight (kDa)

10.88

Isoelectric Point (pI)

50.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011405)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G24175 AT4G24175
fragaria_vesca FvH4_2g38330
malus_domestica MD08G1011800.v1.1 MD08G1012000.v1.1
prunus_persica Prupe.1G364300_v2.0.a1
pyrus_communis pycom08g01020 pycom08g01050 pycom15g00990
rosa_chinensis RchiOBHm_Chr6g0303031
rosa_laevigata RLG00000011114
rosa_multiflora Rmu_ssc0000460.1_g000031
rosa_roxburghii Rroxscaffold_7G00165100
rosa_rugosa Rorug06G0318800.1 Rorug06G0318900.1
rosa_samantha Rh6AG432400 Rh6BG470200 Rh6CG444800 Rh6DG431500
rosa_wichuraiana Rw6G037480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 4 cut(s) 14, 165, 186, 300
AciI CCGC 5 cut(s) 14, 69, 165, 186, 222
AcoI YGGCCR 2 cut(s) 35, 156
AcsI RAATTY 1 cut(s) 232
AcyI GRCGYC 2 cut(s) 168, 213
AfaI GTAC 1 cut(s) 263
AfiI CCNNNNNNNGG 1 cut(s) 309
AflIII ACRYGT 1 cut(s) 384
AgsI TTSAA 2 cut(s) 283, 454
AhdI GACNNNNNGTC 1 cut(s) 302
AjiI CACGTC 1 cut(s) 385
AjnI CCWGG 2 cut(s) 153, 207
AloI GAACNNNNNNTCC 2 cut(s) 411, 443
AoxI GGCC 2 cut(s) 35, 156
ApeKI GCWGC 5 cut(s) 5, 46, 49, 57, 368
ApoI RAATTY 1 cut(s) 232
ArsI GACNNNNNNTTYG 4 cut(s) 342, 374, 411, 443
AspLEI GCGC 2 cut(s) 288, 302
AspS9I GGNCC 3 cut(s) 319, 376, 419
AsuHPI GGTGA 1 cut(s) 100
AsuII TTCGAA 1 cut(s) 230
AvaII GGWCC 3 cut(s) 319, 376, 419
BalI TGGCCA 1 cut(s) 158
BanII GRGCYC 1 cut(s) 192
BbvI GCAGC 4 cut(s) 44, 58, 61, 355
BceAI ACGGC 2 cut(s) 35, 287
BciT130I CCWGG 2 cut(s) 155, 209
BfaI CTAG 2 cut(s) 404, 416
BfoI RGCGCY 1 cut(s) 289
BglI GCCNNNNNGGC 1 cut(s) 43
BisI GCNGC 7 cut(s) 6, 47, 50, 58, 69, 166, 369
BlsI GCNGC 7 cut(s) 7, 48, 51, 59, 70, 167, 370
Bme1390I CCNGG 2 cut(s) 155, 209
Bme18I GGWCC 3 cut(s) 319, 376, 419
BmeRI GACNNNNNGTC 1 cut(s) 302
BmgBI CACGTC 1 cut(s) 385
BmgT120I GGNCC 3 cut(s) 319, 376, 419
BmrFI CCNGG 2 cut(s) 155, 209
BmsI GCATC 2 cut(s) 241, 382
BoxI GACNNNNGTC 1 cut(s) 146
Bpu14I TTCGAA 1 cut(s) 230
BsaAI YACGTR 1 cut(s) 261
BsaHI GRCGYC 2 cut(s) 168, 213
BsaWI WCCGGW 2 cut(s) 103, 421
BsaXI ACNNNNNCTCC 2 cut(s) 311, 341
Bsc4I CCNNNNNNNGG 1 cut(s) 309
Bse1I ACTGG 1 cut(s) 225
Bse3DI GCAATG 2 cut(s) 38, 52
BseBI CCWGG 2 cut(s) 155, 209
BseGI GGATG 3 cut(s) 256, 397, 430
BseLI CCNNNNNNNGG 1 cut(s) 309
BseMI GCAATG 2 cut(s) 38, 52
BseMII CTCAG 2 cut(s) 17, 205
BseNI ACTGG 1 cut(s) 225
BseXI GCAGC 4 cut(s) 44, 58, 61, 355
Bsh1236I CGCG 4 cut(s) 14, 165, 186, 300
BshFI GGCC 2 cut(s) 37, 158
BsiSI CCGG 2 cut(s) 104, 422
BslFI GGGAC 1 cut(s) 30
BslI CCNNNNNNNGG 1 cut(s) 309
BsmFI GGGAC 1 cut(s) 30
BsnI GGCC 2 cut(s) 37, 158
Bsp119I TTCGAA 1 cut(s) 230
Bsp1286I GDGCHC 1 cut(s) 192
BspACI CCGC 5 cut(s) 14, 69, 165, 186, 222
BspANI GGCC 2 cut(s) 37, 158
BspCNI CTCAG 2 cut(s) 18, 204
BspFNI CGCG 4 cut(s) 14, 165, 186, 300
BspT104I TTCGAA 1 cut(s) 230
BsrDI GCAATG 2 cut(s) 38, 52
BsrI ACTGG 1 cut(s) 225
BssNI GRCGYC 2 cut(s) 168, 213
Bst2UI CCWGG 2 cut(s) 155, 209
Bst4CI ACNGT 2 cut(s) 148, 198
BstACI GRCGYC 2 cut(s) 168, 213
BstBAI YACGTR 1 cut(s) 261
BstBI TTCGAA 1 cut(s) 230
BstC8I GCNNGC 1 cut(s) 188
BstDEI CTNAG 2 cut(s) 26, 191
BstEII GGTNACC 1 cut(s) 106
BstF5I GGATG 3 cut(s) 256, 397, 430
BstFNI CGCG 4 cut(s) 14, 165, 186, 300
BstH2I RGCGCY 1 cut(s) 289
BstHHI GCGC 2 cut(s) 288, 302
BstMWI GCNNNNNNNGC 5 cut(s) 11, 28, 43, 221, 299
BstNI CCWGG 2 cut(s) 155, 209
BstPAI GACNNNNGTC 1 cut(s) 146
BstPI GGTNACC 1 cut(s) 106
BstSCI CCNGG 2 cut(s) 153, 207
BstUI CGCG 4 cut(s) 14, 165, 186, 300
BstV1I GCAGC 4 cut(s) 44, 58, 61, 355
BsuRI GGCC 2 cut(s) 37, 158
BtrI CACGTC 1 cut(s) 385
BtsCI GGATG 3 cut(s) 256, 397, 430
Cac8I GCNNGC 1 cut(s) 188
CfoI GCGC 2 cut(s) 288, 302
Cfr13I GGNCC 3 cut(s) 319, 376, 419
CseI GACGC 3 cut(s) 157, 221, 306
Csp6I GTAC 1 cut(s) 262
CviJI RGCY 8 cut(s) 5, 22, 37, 158, 190, 270, 314, 368
CviKI_1 RGCY 8 cut(s) 5, 22, 37, 158, 190, 270, 314, 368
CviQI GTAC 1 cut(s) 262
DdeI CTNAG 2 cut(s) 26, 191
DriI GACNNNNNGTC 1 cut(s) 302
EaeI YGGCCR 2 cut(s) 35, 156
Eam1105I GACNNNNNGTC 1 cut(s) 302
Eco24I GRGCYC 1 cut(s) 192
Eco47I GGWCC 3 cut(s) 319, 376, 419
Eco91I GGTNACC 1 cut(s) 106
EcoO65I GGTNACC 1 cut(s) 106
EcoRII CCWGG 2 cut(s) 153, 207
EcoT38I GRGCYC 1 cut(s) 192
FaiI YATR 4 cut(s) 174, 317, 459, 467
FaqI GGGAC 1 cut(s) 30
FauI CCCGC 2 cut(s) 7, 179
Fnu4HI GCNGC 7 cut(s) 6, 47, 50, 58, 69, 166, 369
FokI GGATG 3 cut(s) 263, 404, 437
FriOI GRGCYC 1 cut(s) 192
Fsp4HI GCNGC 7 cut(s) 6, 47, 50, 58, 69, 166, 369
FspBI CTAG 2 cut(s) 404, 416
GlaI GCGC 2 cut(s) 287, 301
GluI GCNGC 7 cut(s) 6, 47, 50, 58, 69, 166, 369
HaeII RGCGCY 1 cut(s) 289
HaeIII GGCC 2 cut(s) 37, 158
HapII CCGG 2 cut(s) 104, 422
HgaI GACGC 3 cut(s) 157, 221, 306
HhaI GCGC 2 cut(s) 288, 302
Hin1I GRCGYC 2 cut(s) 168, 213
Hin6I GCGC 2 cut(s) 286, 300
HinP1I GCGC 2 cut(s) 286, 300
HinfI GANTC 2 cut(s) 245, 400
HpaII CCGG 2 cut(s) 104, 422
HphI GGTGA 1 cut(s) 100
Hpy166II GTNNAC 1 cut(s) 151
Hpy188I TCNGA 6 cut(s) 27, 194, 202, 244, 250, 362
Hpy188III TCNNGA 2 cut(s) 374, 431
Hpy8I GTNNAC 1 cut(s) 151
Hpy99I CGWCG 2 cut(s) 132, 300
HpyAV CCTTC 4 cut(s) 82, 340, 428, 438
HpyCH4III ACNGT 2 cut(s) 148, 198
HpyCH4IV ACGT 2 cut(s) 260, 384
HpyCH4V TGCA 1 cut(s) 254
HpyF10VI GCNNNNNNNGC 5 cut(s) 11, 28, 43, 221, 299
HpyF3I CTNAG 2 cut(s) 26, 191
HpySE526I ACGT 2 cut(s) 260, 384
Hsp92I GRCGYC 2 cut(s) 168, 213
HspAI GCGC 2 cut(s) 286, 300
LpnPI CCDG 9 cut(s) 117, 127, 140, 167, 194, 221, 238, 359, 435
Lsp1109I GCAGC 4 cut(s) 44, 58, 61, 355
LweI GCATC 2 cut(s) 241, 382
MaeI CTAG 2 cut(s) 404, 416
MaeII ACGT 2 cut(s) 260, 384
MaeIII GTNAC 2 cut(s) 106, 256
MboII GAAGA 2 cut(s) 79, 421
MhlI GDGCHC 1 cut(s) 192
MlsI TGGCCA 1 cut(s) 158
MluCI AATT 2 cut(s) 232, 454
MluNI TGGCCA 1 cut(s) 158
MmeI TCCRAC 1 cut(s) 369
MnlI CCTC 4 cut(s) 21, 332, 337, 351
Mox20I TGGCCA 1 cut(s) 158
MscI TGGCCA 1 cut(s) 158
Msp20I TGGCCA 1 cut(s) 158
MspI CCGG 2 cut(s) 104, 422
MspR9I CCNGG 2 cut(s) 155, 209
MvaI CCWGG 2 cut(s) 155, 209
MvnI CGCG 4 cut(s) 14, 165, 186, 300
MwoI GCNNNNNNNGC 5 cut(s) 11, 28, 43, 221, 299
NmuCI GTSAC 2 cut(s) 106, 256
NspV TTCGAA 1 cut(s) 230
PcsI WCGNNNNNNNCGW 1 cut(s) 304
PfeI GAWTC 2 cut(s) 245, 400
PkrI GCNGC 7 cut(s) 7, 48, 51, 59, 70, 167, 370
Ppu21I YACGTR 1 cut(s) 261
PshAI GACNNNNGTC 1 cut(s) 146
Psp6I CCWGG 2 cut(s) 153, 207
PspEI GGTNACC 1 cut(s) 106
PspGI CCWGG 2 cut(s) 153, 207
PspPI GGNCC 3 cut(s) 319, 376, 419
RsaI GTAC 1 cut(s) 263
RsaNI GTAC 1 cut(s) 262
SatI GCNGC 7 cut(s) 6, 47, 50, 58, 69, 166, 369
Sau96I GGNCC 3 cut(s) 319, 376, 419
ScrFI CCNGG 2 cut(s) 155, 209
SduI GDGCHC 1 cut(s) 192
SetI ASST 6 cut(s) 84, 156, 241, 263, 324, 387
SfaNI GCATC 2 cut(s) 241, 382
SfuI TTCGAA 1 cut(s) 230
SinI GGWCC 3 cut(s) 319, 376, 419
Sse9I AATT 2 cut(s) 232, 454
SsiI CCGC 5 cut(s) 14, 69, 165, 186, 222
SspMI CTAG 2 cut(s) 404, 416
StyD4I CCNGG 2 cut(s) 153, 207
TaaI ACNGT 2 cut(s) 148, 198
TaiI ACGT 2 cut(s) 263, 387
TaqI TCGA 2 cut(s) 230, 430
TasI AATT 2 cut(s) 232, 454
TauI GCSGC 2 cut(s) 71, 168
TfiI GAWTC 2 cut(s) 245, 400
TseFI GTSAC 2 cut(s) 106, 256
TseI GCWGC 5 cut(s) 5, 46, 49, 57, 368
Tsp45I GTSAC 2 cut(s) 106, 256
TspGWI ACGGA 2 cut(s) 123, 296
VpaK11BI GGWCC 3 cut(s) 319, 376, 419
XapI RAATTY 1 cut(s) 232
XcmI CCANNNNNNNNNTGG 1 cut(s) 151
XspI CTAG 2 cut(s) 404, 416
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.