pycom09g17310

Zinc-finger of C2H2 type

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
17795910 .. 17796271
362 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 204 bp
ATGATAAAGCGGCGATTCTACAAGCTAGAACATGGCGACAGAGATGGCCCCTCCAATTCATCTTCATCCTCGTCGGATTCTGAAATGGAACCACAAGCCACAGACGACTCGGATGAAGAAGAAGAAGAAGAAGAAGAACAATATGATGCAGTCCAAGAACTCAAGGACGATGCTCAGTCCTGCTCTACCTCCTCTGCAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.55

Weight (kDa)

4.08

Isoelectric Point (pI)

108.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 10
AluBI AGCT 1 cut(s) 25
AluI AGCT 1 cut(s) 25
AoxI GGCC 1 cut(s) 46
AspS9I GGNCC 1 cut(s) 47
BccI CCATC 1 cut(s) 38
BfaI CTAG 1 cut(s) 26
BisI GCNGC 1 cut(s) 11
BlsI GCNGC 1 cut(s) 12
BmgT120I GGNCC 1 cut(s) 47
BmiI GGNNCC 2 cut(s) 49, 90
BmsI GCATC 2 cut(s) 136, 160
BpuEI CTTGAG 1 cut(s) 146
BseGI GGATG 2 cut(s) 65, 118
BseMII CTCAG 1 cut(s) 188
BseRI GAGGAG 1 cut(s) 181
BshFI GGCC 1 cut(s) 48
BsnI GGCC 1 cut(s) 48
BspACI CCGC 1 cut(s) 10
BspANI GGCC 1 cut(s) 48
BspCNI CTCAG 1 cut(s) 187
BspLI GGNNCC 2 cut(s) 49, 90
BstDEI CTNAG 1 cut(s) 174
BstF5I GGATG 2 cut(s) 65, 118
BsuRI GGCC 1 cut(s) 48
BtsCI GGATG 2 cut(s) 65, 118
Cfr13I GGNCC 1 cut(s) 47
CviAII CATG 1 cut(s) 32
CviJI RGCY 3 cut(s) 25, 48, 98
CviKI_1 RGCY 3 cut(s) 25, 48, 98
DdeI CTNAG 1 cut(s) 174
FaeI CATG 1 cut(s) 35
FaiI YATR 2 cut(s) 33, 144
FatI CATG 1 cut(s) 31
Fnu4HI GCNGC 1 cut(s) 11
FokI GGATG 2 cut(s) 52, 125
Fsp4HI GCNGC 1 cut(s) 11
FspBI CTAG 1 cut(s) 26
GluI GCNGC 1 cut(s) 11
HaeIII GGCC 1 cut(s) 48
Hin1II CATG 1 cut(s) 35
HinfI GANTC 3 cut(s) 15, 77, 107
Hpy188I TCNGA 3 cut(s) 76, 82, 112
Hpy99I CGWCG 1 cut(s) 76
HpyCH4V TGCA 2 cut(s) 149, 197
HpyF3I CTNAG 1 cut(s) 174
Hsp92II CATG 1 cut(s) 35
LpnPI CCDG 1 cut(s) 193
LweI GCATC 2 cut(s) 136, 160
MaeI CTAG 1 cut(s) 26
MboII GAAGA 8 cut(s) 54, 128, 131, 134, 137, 140, 143, 146
MluCI AATT 1 cut(s) 55
MlyI GAGTC 1 cut(s) 101
MmeI TCCRAC 1 cut(s) 54
MnlI CCTC 4 cut(s) 61, 79, 199, 202
NlaIII CATG 1 cut(s) 35
NlaIV GGNNCC 2 cut(s) 49, 90
PfeI GAWTC 2 cut(s) 15, 77
PkrI GCNGC 1 cut(s) 12
PleI GAGTC 1 cut(s) 101
PpsI GAGTC 1 cut(s) 101
PspN4I GGNNCC 2 cut(s) 49, 90
PspPI GGNCC 1 cut(s) 47
SatI GCNGC 1 cut(s) 11
Sau96I GGNCC 1 cut(s) 47
SchI GAGTC 1 cut(s) 101
SetI ASST 2 cut(s) 27, 191
SfaNI GCATC 2 cut(s) 136, 160
SgeI CNNG 9 cut(s) 34, 38, 44, 82, 107, 121, 167, 175, 192
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
Sse9I AATT 1 cut(s) 55
SsiI CCGC 1 cut(s) 10
SspMI CTAG 1 cut(s) 26
TasI AATT 1 cut(s) 55
TauI GCSGC 1 cut(s) 13
TfiI GAWTC 2 cut(s) 15, 77
TspDTI ATGAA 3 cut(s) 48, 54, 129
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.