pycom09g18320

IST1 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
OG0015717
Physical Location & Seq
Forward (+)
18933897 .. 18934297
401 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g18320.2

Sequence Viewer

Length: 345 bp
ATGGGTAGATCAAAATTTACAAATAGAAATACAAAACCAAAAAACAACCCAAGAGATTGGTTGATTAAGGGGTTAGAGATTTGGATCTTATCATTGGTATCATCCTTCTCGAATCCTGGTTTCCCTCATGTGTACGCCCACCCGACCCGTCTTCCTATCATGGATGCACGCCTCTCTACTGCAATCGACTCATTTGAAGCTTTGATACATGTTGCGATCCGTGATGCAATCCACGAAGCTATGGATTCTACACTCACCGATATTCACAAGGCTGTGAATCATATACTCGTAGAAATCCGTAGTGACCTTGCTCAGTTACGCGGTGACTCGACTCTCGGCGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04144 map04144
Pfam Domains
Protein Families
Ist1

Protein Analysis

115

Amino Acids

12.78

Weight (kDa)

8.2

Isoelectric Point (pI)

41.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 321
AciI CCGC 1 cut(s) 321
AclWI GGATC 2 cut(s) 92, 211
AcsI RAATTY 1 cut(s) 14
AcyI GRCGYC 1 cut(s) 339
AfaI GTAC 1 cut(s) 134
AflIII ACRYGT 1 cut(s) 208
AgsI TTSAA 1 cut(s) 197
AjnI CCWGG 1 cut(s) 115
AluBI AGCT 2 cut(s) 200, 239
AluI AGCT 2 cut(s) 200, 239
AlwI GGATC 2 cut(s) 92, 211
ApoI RAATTY 1 cut(s) 14
AsuHPI GGTGA 2 cut(s) 247, 335
BarI GAAGNNNNNNTAC 2 cut(s) 189, 221
BbsI GAAGAC 1 cut(s) 143
BciT130I CCWGG 1 cut(s) 117
BfaI CTAG 1 cut(s) 343
Bme1390I CCNGG 1 cut(s) 117
BmrFI CCNGG 1 cut(s) 117
BmsI GCATC 2 cut(s) 154, 214
BpiI GAAGAC 1 cut(s) 143
BsaBI GATNNNNATC 1 cut(s) 83
BsaHI GRCGYC 1 cut(s) 339
Bse8I GATNNNNATC 1 cut(s) 83
BseBI CCWGG 1 cut(s) 117
BseGI GGATG 2 cut(s) 101, 169
BseJI GATNNNNATC 1 cut(s) 83
BseMII CTCAG 1 cut(s) 326
Bsh1236I CGCG 1 cut(s) 321
Bsp143I GATC 3 cut(s) 8, 84, 216
BspACI CCGC 1 cut(s) 321
BspCNI CTCAG 1 cut(s) 325
BspFNI CGCG 1 cut(s) 321
BspPI GGATC 2 cut(s) 92, 211
BssMI GATC 3 cut(s) 8, 84, 216
BssNI GRCGYC 1 cut(s) 339
Bst2UI CCWGG 1 cut(s) 117
BstACI GRCGYC 1 cut(s) 339
BstC8I GCNNGC 1 cut(s) 169
BstDEI CTNAG 1 cut(s) 312
BstF5I GGATG 2 cut(s) 101, 169
BstFNI CGCG 1 cut(s) 321
BstKTI GATC 3 cut(s) 11, 87, 219
BstMBI GATC 3 cut(s) 8, 84, 216
BstNI CCWGG 1 cut(s) 117
BstNSI RCATGY 1 cut(s) 212
BstSCI CCNGG 1 cut(s) 115
BstUI CGCG 1 cut(s) 321
BstV2I GAAGAC 1 cut(s) 143
BstX2I RGATCY 1 cut(s) 84
BstXI CCANNNNNNTGG 1 cut(s) 57
BstYI RGATCY 1 cut(s) 84
BtsCI GGATG 2 cut(s) 101, 169
Cac8I GCNNGC 1 cut(s) 169
CseI GACGC 1 cut(s) 328
Csp6I GTAC 1 cut(s) 133
CviAII CATG 3 cut(s) 128, 160, 209
CviJI RGCY 3 cut(s) 200, 239, 272
CviKI_1 RGCY 3 cut(s) 200, 239, 272
CviQI GTAC 1 cut(s) 133
DdeI CTNAG 1 cut(s) 312
DpnI GATC 3 cut(s) 10, 86, 218
DpnII GATC 3 cut(s) 8, 84, 216
EcoRII CCWGG 1 cut(s) 115
FaeI CATG 3 cut(s) 131, 163, 212
FaiI YATR 6 cut(s) 129, 161, 210, 242, 282, 284
FatI CATG 3 cut(s) 127, 159, 208
FokI GGATG 2 cut(s) 88, 176
FspBI CTAG 1 cut(s) 343
HgaI GACGC 1 cut(s) 328
Hin1I GRCGYC 1 cut(s) 339
Hin1II CATG 3 cut(s) 131, 163, 212
HindIII AAGCTT 1 cut(s) 198
HinfI GANTC 6 cut(s) 112, 188, 245, 277, 326, 331
HphI GGTGA 2 cut(s) 247, 335
Hpy166II GTNNAC 1 cut(s) 133
Hpy188III TCNNGA 1 cut(s) 109
Hpy8I GTNNAC 1 cut(s) 133
HpyAV CCTTC 1 cut(s) 115
HpyCH4V TGCA 3 cut(s) 167, 182, 227
HpyF3I CTNAG 1 cut(s) 312
Hsp92I GRCGYC 1 cut(s) 339
Hsp92II CATG 3 cut(s) 131, 163, 212
Kzo9I GATC 3 cut(s) 8, 84, 216
LpnPI CCDG 2 cut(s) 102, 129
LweI GCATC 2 cut(s) 154, 214
MaeI CTAG 1 cut(s) 343
MaeIII GTNAC 3 cut(s) 302, 315, 323
MalI GATC 3 cut(s) 10, 86, 218
MboI GATC 3 cut(s) 8, 84, 216
MboII GAAGA 1 cut(s) 143
MflI RGATCY 1 cut(s) 84
MluCI AATT 1 cut(s) 14
MlyI GAGTC 3 cut(s) 182, 320, 325
MnlI CCTC 2 cut(s) 135, 182
MseI TTAA 1 cut(s) 66
MspR9I CCNGG 1 cut(s) 117
MvaI CCWGG 1 cut(s) 117
MvnI CGCG 1 cut(s) 321
NdeII GATC 3 cut(s) 8, 84, 216
NlaIII CATG 3 cut(s) 131, 163, 212
NmeAIII GCCGAG 1 cut(s) 315
NmuCI GTSAC 2 cut(s) 302, 323
NspI RCATGY 1 cut(s) 212
PciI ACATGT 1 cut(s) 208
PfeI GAWTC 3 cut(s) 112, 245, 277
PleI GAGTC 3 cut(s) 182, 320, 325
PpsI GAGTC 3 cut(s) 182, 320, 325
PscI ACATGT 1 cut(s) 208
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
PsuI RGATCY 1 cut(s) 84
RsaI GTAC 1 cut(s) 134
RsaNI GTAC 1 cut(s) 133
SaqAI TTAA 1 cut(s) 66
Sau3AI GATC 3 cut(s) 8, 84, 216
SchI GAGTC 3 cut(s) 182, 320, 325
ScrFI CCNGG 1 cut(s) 117
SetI ASST 3 cut(s) 202, 241, 309
SfaNI GCATC 2 cut(s) 154, 214
Sse9I AATT 1 cut(s) 14
SsiI CCGC 1 cut(s) 321
SspMI CTAG 1 cut(s) 343
StyD4I CCNGG 1 cut(s) 115
TaqI TCGA 3 cut(s) 110, 186, 329
TasI AATT 1 cut(s) 14
TfiI GAWTC 3 cut(s) 112, 245, 277
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TseFI GTSAC 2 cut(s) 302, 323
Tsp45I GTSAC 2 cut(s) 302, 323
TspGWI ACGGA 2 cut(s) 209, 287
XapI RAATTY 1 cut(s) 14
XceI RCATGY 1 cut(s) 212
XspI CTAG 1 cut(s) 343
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.