pycom09g19860

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
20708811 .. 20709068
258 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 258 bp
ATGTTTGGAAATCTACGGATGTCTATTTTCTGGAGCATTTCGCGGATTGTTAATATCATTTTTCTAGAAGAAGTTATGGCCGTTTTAACACTGAAAGGTTCCCAAGAGGCTGAGCAGTTTGTAACTGACAAGAAAGCATTGAAAGCAATAAATCCAATAAATCTAGCAGCCAAAACTGATGCAATCAAGAAAAACCAGCTAACACCTATTCAAATATCAGAGGAAATGGAATTAAAGATGAGGATTAAGAGGGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

86

Amino Acids

9.77

Weight (kDa)

9.45

Isoelectric Point (pI)

37.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 43
AciI CCGC 1 cut(s) 43
AcoI YGGCCR 1 cut(s) 78
AgsI TTSAA 2 cut(s) 142, 212
AluBI AGCT 1 cut(s) 199
AluI AGCT 1 cut(s) 199
AoxI GGCC 1 cut(s) 78
ApeKI GCWGC 1 cut(s) 167
BbvI GCAGC 1 cut(s) 179
BceAI ACGGC 1 cut(s) 65
BfaI CTAG 2 cut(s) 65, 164
BisI GCNGC 1 cut(s) 168
BlpI GCTNAGC 1 cut(s) 111
BlsI GCNGC 1 cut(s) 169
BmiI GGNNCC 1 cut(s) 100
BmsI GCATC 1 cut(s) 169
BpmI CTGGAG 1 cut(s) 52
Bpu1102I GCTNAGC 1 cut(s) 111
BseGI GGATG 1 cut(s) 24
BseMII CTCAG 1 cut(s) 102
BseXI GCAGC 1 cut(s) 179
Bsh1236I CGCG 1 cut(s) 43
BshFI GGCC 1 cut(s) 80
BsnI GGCC 1 cut(s) 80
Bsp1720I GCTNAGC 1 cut(s) 111
BspACI CCGC 1 cut(s) 43
BspANI GGCC 1 cut(s) 80
BspCNI CTCAG 1 cut(s) 103
BspFNI CGCG 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 100
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 24
BstFNI CGCG 1 cut(s) 43
BstMWI GCNNNNNNNGC 1 cut(s) 143
BstUI CGCG 1 cut(s) 43
BstV1I GCAGC 1 cut(s) 179
BsuRI GGCC 1 cut(s) 80
BtsCI GGATG 1 cut(s) 24
BtsIMutI CAGTG 1 cut(s) 89
CviJI RGCY 4 cut(s) 80, 110, 170, 199
CviKI_1 RGCY 4 cut(s) 80, 110, 170, 199
DdeI CTNAG 1 cut(s) 111
EaeI YGGCCR 1 cut(s) 78
FaiI YATR 1 cut(s) 77
Fnu4HI GCNGC 1 cut(s) 168
FokI GGATG 1 cut(s) 31
Fsp4HI GCNGC 1 cut(s) 168
FspBI CTAG 2 cut(s) 65, 164
GluI GCNGC 1 cut(s) 168
GsuI CTGGAG 1 cut(s) 52
HaeIII GGCC 1 cut(s) 80
Hpy188I TCNGA 1 cut(s) 220
Hpy188III TCNNGA 3 cut(s) 31, 65, 187
HpyCH4V TGCA 1 cut(s) 182
HpyF10VI GCNNNNNNNGC 1 cut(s) 143
HpyF3I CTNAG 1 cut(s) 111
LmnI GCTCC 1 cut(s) 33
LpnPI CCDG 2 cut(s) 16, 209
Lsp1109I GCAGC 1 cut(s) 179
LweI GCATC 1 cut(s) 169
MaeI CTAG 2 cut(s) 65, 164
MaeIII GTNAC 1 cut(s) 121
MboII GAAGA 1 cut(s) 80
MluCI AATT 1 cut(s) 230
MnlI CCTC 4 cut(s) 100, 214, 234, 243
MseI TTAA 4 cut(s) 51, 86, 233, 246
MvnI CGCG 1 cut(s) 43
MwoI GCNNNNNNNGC 1 cut(s) 143
NlaIV GGNNCC 1 cut(s) 100
PkrI GCNGC 1 cut(s) 169
PspN4I GGNNCC 1 cut(s) 100
SaqAI TTAA 4 cut(s) 51, 86, 233, 246
SatI GCNGC 1 cut(s) 168
SetI ASST 3 cut(s) 100, 201, 208
SfaNI GCATC 1 cut(s) 169
SgeI CNNG 8 cut(s) 43, 54, 77, 116, 142, 176, 199, 208
Sse9I AATT 1 cut(s) 230
SsiI CCGC 1 cut(s) 43
SspMI CTAG 2 cut(s) 65, 164
TasI AATT 1 cut(s) 230
Tru1I TTAA 4 cut(s) 51, 86, 233, 246
Tru9I TTAA 4 cut(s) 51, 86, 233, 246
TscAI CASTG 1 cut(s) 96
TseI GCWGC 1 cut(s) 167
TspGWI ACGGA 1 cut(s) 31
TspRI CASTG 1 cut(s) 96
XbaI TCTAGA 1 cut(s) 64
XspI CTAG 2 cut(s) 65, 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.