pycom111g01700

Bromodomain extra-terminal - transcription regulation

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_111
Physical Location & Seq
Forward (+)
1054368 .. 1054853
486 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGTCCTCTTGCAGGCCGATGACCCTTGGTGAGAAACACAAGCTTGGAAAACTGATTCAGAAGTTACCACCGAAAAATCTTGACCATGTTGCGGAAATGATCCAGCATAGGAACGCAGCTTATACAAATTCACCTGATGAAATTCGTGTGGACCTTGAAAGACAGAGTAATATAACACTTTGGAGACTGTATTATTATGTTGAAGCAGTCGAGAAAGCTAGAAAGCTCGCCAAGTACGAATCCAGTGGAAGTTCACTGAATCAGGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.25

Weight (kDa)

9.33

Isoelectric Point (pI)

48.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BET PF17035 6 - 68 1.5e-20 Bromodomain extra-terminal - transcription regulation
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 92
AclWI GGATC 1 cut(s) 94
AcsI RAATTY 2 cut(s) 127, 141
AfaI GTAC 1 cut(s) 236
AfiI CCNNNNNNNGG 2 cut(s) 12, 91
AgsI TTSAA 2 cut(s) 158, 203
AluBI AGCT 4 cut(s) 43, 119, 218, 226
AluI AGCT 4 cut(s) 43, 119, 218, 226
Alw26I GTCTC 1 cut(s) 178
AlwI GGATC 1 cut(s) 94
AoxI GGCC 1 cut(s) 14
ApeKI GCWGC 1 cut(s) 116
ApoI RAATTY 2 cut(s) 127, 141
AspS9I GGNCC 1 cut(s) 151
AsuHPI GGTGA 2 cut(s) 41, 123
AvaII GGWCC 1 cut(s) 151
BbvI GCAGC 1 cut(s) 128
BcoDI GTCTC 1 cut(s) 178
BfaI CTAG 1 cut(s) 219
BisI GCNGC 1 cut(s) 117
BlsI GCNGC 1 cut(s) 118
Bme18I GGWCC 1 cut(s) 151
BmgT120I GGNCC 1 cut(s) 151
BsaJI CCNNGG 1 cut(s) 25
Bsc4I CCNNNNNNNGG 2 cut(s) 12, 91
Bse1I ACTGG 1 cut(s) 243
BseDI CCNNGG 1 cut(s) 25
BseLI CCNNNNNNNGG 2 cut(s) 12, 91
BseNI ACTGG 1 cut(s) 243
BseXI GCAGC 1 cut(s) 128
BshFI GGCC 1 cut(s) 16
BslI CCNNNNNNNGG 2 cut(s) 12, 91
BsmAI GTCTC 1 cut(s) 178
BsnI GGCC 1 cut(s) 16
Bsp143I GATC 1 cut(s) 99
BspACI CCGC 1 cut(s) 92
BspANI GGCC 1 cut(s) 16
BspPI GGATC 1 cut(s) 94
BsrI ACTGG 1 cut(s) 243
BssECI CCNNGG 1 cut(s) 25
BssMI GATC 1 cut(s) 99
BssT1I CCWWGG 1 cut(s) 25
Bst4CI ACNGT 1 cut(s) 189
BstC8I GCNNGC 2 cut(s) 14, 228
BstENI CCTNNNNNAGG 1 cut(s) 10
BstKTI GATC 1 cut(s) 102
BstMAI GTCTC 1 cut(s) 178
BstMBI GATC 1 cut(s) 99
BstV1I GCAGC 1 cut(s) 128
BsuRI GGCC 1 cut(s) 16
BtsIMutI CAGTG 2 cut(s) 250, 254
Cac8I GCNNGC 2 cut(s) 14, 228
Cfr13I GGNCC 1 cut(s) 151
Csp6I GTAC 1 cut(s) 235
CviAII CATG 1 cut(s) 86
CviJI RGCY 6 cut(s) 16, 43, 119, 218, 226, 267
CviKI_1 RGCY 6 cut(s) 16, 43, 119, 218, 226, 267
CviQI GTAC 1 cut(s) 235
DpnI GATC 1 cut(s) 101
DpnII GATC 1 cut(s) 99
Eco130I CCWWGG 1 cut(s) 25
Eco47I GGWCC 1 cut(s) 151
EcoNI CCTNNNNNAGG 1 cut(s) 10
EcoT14I CCWWGG 1 cut(s) 25
ErhI CCWWGG 1 cut(s) 25
FaeI CATG 1 cut(s) 89
FaiI YATR 5 cut(s) 87, 108, 123, 173, 198
FatI CATG 1 cut(s) 85
Fnu4HI GCNGC 1 cut(s) 117
Fsp4HI GCNGC 1 cut(s) 117
FspBI CTAG 1 cut(s) 219
GluI GCNGC 1 cut(s) 117
HaeIII GGCC 1 cut(s) 16
Hin1II CATG 1 cut(s) 89
HindIII AAGCTT 1 cut(s) 41
HinfI GANTC 3 cut(s) 55, 239, 259
HphI GGTGA 2 cut(s) 41, 123
Hpy166II GTNNAC 2 cut(s) 151, 254
Hpy188I TCNGA 1 cut(s) 60
Hpy188III TCNNGA 2 cut(s) 80, 211
Hpy8I GTNNAC 2 cut(s) 151, 254
HpyCH4III ACNGT 1 cut(s) 189
HpyCH4V TGCA 1 cut(s) 12
Hsp92II CATG 1 cut(s) 89
Kzo9I GATC 1 cut(s) 99
LpnPI CCDG 4 cut(s) 116, 147, 248, 256
Lsp1109I GCAGC 1 cut(s) 128
MaeI CTAG 1 cut(s) 219
MaeIII GTNAC 1 cut(s) 63
MalI GATC 1 cut(s) 101
MboI GATC 1 cut(s) 99
MluCI AATT 2 cut(s) 127, 141
MnlI CCTC 1 cut(s) 16
NdeII GATC 1 cut(s) 99
NlaIII CATG 1 cut(s) 89
PcsI WCGNNNNNNNCGW 1 cut(s) 234
PfeI GAWTC 3 cut(s) 55, 239, 259
PkrI GCNGC 1 cut(s) 118
PspPI GGNCC 1 cut(s) 151
RsaI GTAC 1 cut(s) 236
RsaNI GTAC 1 cut(s) 235
SatI GCNGC 1 cut(s) 117
Sau3AI GATC 1 cut(s) 99
Sau96I GGNCC 1 cut(s) 151
SetI ASST 6 cut(s) 45, 121, 136, 156, 220, 228
SinI GGWCC 1 cut(s) 151
Sse9I AATT 2 cut(s) 127, 141
SsiI CCGC 1 cut(s) 92
SspMI CTAG 1 cut(s) 219
StyI CCWWGG 1 cut(s) 25
TaaI ACNGT 1 cut(s) 189
TaqI TCGA 1 cut(s) 210
TasI AATT 2 cut(s) 127, 141
TfiI GAWTC 3 cut(s) 55, 239, 259
TscAI CASTG 2 cut(s) 250, 261
TseI GCWGC 1 cut(s) 116
TspDTI ATGAA 1 cut(s) 153
TspRI CASTG 2 cut(s) 250, 261
VpaK11BI GGWCC 1 cut(s) 151
XagI CCTNNNNNAGG 1 cut(s) 10
XapI RAATTY 2 cut(s) 127, 141
XspI CTAG 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.