pycom13g25970

Vesicle transport protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Reverse (-)
22702402 .. 22703187
786 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g25970.1

Sequence Viewer

Length: 225 bp
ATGAATGATCGAAAAAAGATTGGACTAGGATTGACTGGATTCGGCATATTTTTCACATGCCTGGGAATGGCCTTCTTCTTTGACAAGGGATTGCTTGCAATGGGAAATATCCTCTTCTTGTCAGGGGTGACTTTAACCATTGGATTTAAGCCCACGGCGCAATTCTTCATGAAACGTCAAAATTATAAGGAACAATTTCTTTTGGTATTGGTTTCTTCTTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.29

Weight (kDa)

9.9

Isoelectric Point (pI)

22.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 186
AfiI CCNNNNNNNGG 1 cut(s) 67
AjnI CCWGG 1 cut(s) 60
AoxI GGCC 1 cut(s) 69
Asp700I GAANNNNTTC 1 cut(s) 195
AspLEI GCGC 1 cut(s) 160
AsuHPI GGTGA 1 cut(s) 139
BceAI ACGGC 1 cut(s) 171
BciT130I CCWGG 1 cut(s) 62
BfaI CTAG 1 cut(s) 26
Bme1390I CCNGG 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 62
BsaJI CCNNGG 2 cut(s) 61, 153
Bsc4I CCNNNNNNNGG 1 cut(s) 67
Bse1I ACTGG 1 cut(s) 40
Bse3DI GCAATG 1 cut(s) 105
BseBI CCWGG 1 cut(s) 62
BseDI CCNNGG 2 cut(s) 61, 153
BseLI CCNNNNNNNGG 1 cut(s) 67
BseMI GCAATG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 40
BshFI GGCC 1 cut(s) 71
BslI CCNNNNNNNGG 1 cut(s) 67
BsnI GGCC 1 cut(s) 71
Bsp143I GATC 1 cut(s) 7
BspANI GGCC 1 cut(s) 71
BspHI TCATGA 1 cut(s) 168
BsrDI GCAATG 1 cut(s) 105
BsrI ACTGG 1 cut(s) 40
BssECI CCNNGG 2 cut(s) 61, 153
BssMI GATC 1 cut(s) 7
Bst2UI CCWGG 1 cut(s) 62
Bst6I CTCTTC 1 cut(s) 119
BstC8I GCNNGC 1 cut(s) 96
BstDSI CCRYGG 1 cut(s) 153
BstHHI GCGC 1 cut(s) 160
BstKTI GATC 1 cut(s) 10
BstMBI GATC 1 cut(s) 7
BstMWI GCNNNNNNNGC 1 cut(s) 157
BstNI CCWGG 1 cut(s) 62
BstNSI RCATGY 1 cut(s) 60
BstSCI CCNGG 1 cut(s) 60
BsuRI GGCC 1 cut(s) 71
BtgI CCRYGG 1 cut(s) 153
Cac8I GCNNGC 1 cut(s) 96
CciI TCATGA 1 cut(s) 168
CfoI GCGC 1 cut(s) 160
CviAII CATG 2 cut(s) 57, 169
CviJI RGCY 2 cut(s) 71, 151
CviKI_1 RGCY 2 cut(s) 71, 151
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
Eam1104I CTCTTC 1 cut(s) 119
EarI CTCTTC 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 60
FaeI CATG 2 cut(s) 60, 172
FaiI YATR 4 cut(s) 47, 58, 170, 186
FatI CATG 2 cut(s) 56, 168
FspBI CTAG 1 cut(s) 26
GlaI GCGC 1 cut(s) 159
HaeIII GGCC 1 cut(s) 71
HhaI GCGC 1 cut(s) 160
Hin1II CATG 2 cut(s) 60, 172
Hin6I GCGC 1 cut(s) 158
HinP1I GCGC 1 cut(s) 158
HinfI GANTC 1 cut(s) 39
HphI GGTGA 1 cut(s) 139
Hpy188III TCNNGA 1 cut(s) 169
HpyAV CCTTC 1 cut(s) 82
HpyCH4IV ACGT 1 cut(s) 175
HpyCH4V TGCA 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 157
HpySE526I ACGT 1 cut(s) 175
Hsp92II CATG 2 cut(s) 60, 172
HspAI GCGC 1 cut(s) 158
Kzo9I GATC 1 cut(s) 7
LpnPI CCDG 4 cut(s) 21, 47, 74, 108
MaeI CTAG 1 cut(s) 26
MaeII ACGT 1 cut(s) 175
MaeIII GTNAC 1 cut(s) 127
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MboII GAAGA 4 cut(s) 67, 106, 157, 207
MluCI AATT 3 cut(s) 161, 181, 194
MnlI CCTC 1 cut(s) 122
MroXI GAANNNNTTC 1 cut(s) 195
MseI TTAA 2 cut(s) 134, 147
MspR9I CCNGG 1 cut(s) 62
MvaI CCWGG 1 cut(s) 62
MwoI GCNNNNNNNGC 1 cut(s) 157
NdeII GATC 1 cut(s) 7
NlaIII CATG 2 cut(s) 60, 172
NmuCI GTSAC 1 cut(s) 127
NspI RCATGY 1 cut(s) 60
PagI TCATGA 1 cut(s) 168
PdmI GAANNNNTTC 1 cut(s) 195
PfeI GAWTC 1 cut(s) 39
PsiI TTATAA 1 cut(s) 186
Psp6I CCWGG 1 cut(s) 60
PspGI CCWGG 1 cut(s) 60
SaqAI TTAA 2 cut(s) 134, 147
Sau3AI GATC 1 cut(s) 7
ScrFI CCNGG 1 cut(s) 62
SetI ASST 1 cut(s) 178
Sse9I AATT 3 cut(s) 161, 181, 194
SspMI CTAG 1 cut(s) 26
StyD4I CCNGG 1 cut(s) 60
TaiI ACGT 1 cut(s) 178
TaqI TCGA 1 cut(s) 10
TasI AATT 3 cut(s) 161, 181, 194
TfiI GAWTC 1 cut(s) 39
Tru1I TTAA 2 cut(s) 134, 147
Tru9I TTAA 2 cut(s) 134, 147
TseFI GTSAC 1 cut(s) 127
Tsp45I GTSAC 1 cut(s) 127
TspDTI ATGAA 3 cut(s) 17, 157, 185
XceI RCATGY 1 cut(s) 60
XmnI GAANNNNTTC 1 cut(s) 195
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.