Rh4CG151900

Vesicle transport protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0004920
Physical Location & Seq
Reverse (-)
33489847 .. 33495967
6121 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG151900.1

Sequence Viewer

Length: 321 bp
ATGGTTTTTTTCTTTGACAAGGGATTACTTGCAATGGGAAATATCCTCTTCTTCTCAGGGGTGACTTTAACAATTGGATTTAAGTCCACACTGCAATTCTTCATGAAACGTCAAAATTTTAAGGGGTCAATTTCTTTTGGTGTTGGGTTCTTCTTTGTGCTCATAGGATGGCCAATTGTGGGCATGATTTTGGAGGCATATGGTTTCATTGTACTCTTCAGTGGCTTCTGGCCAACATTGGCAGTTTTTCTGCAGAAGATTCCAATTCTGGGATGGGTGGTCCAACAGCCATATATTAGATCGGTATGTTCAGTTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Got1

Protein Analysis

106

Amino Acids

11.97

Weight (kDa)

9.7

Isoelectric Point (pI)

26.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Got1 PF04178 8 - 88 2.5e-12 Got1/Sft2-like family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 170, 230
AcsI RAATTY 1 cut(s) 115
AcuI CTGAAG 1 cut(s) 202
AfaI GTAC 1 cut(s) 213
AfiI CCNNNNNNNGG 2 cut(s) 179, 269
Alw21I GWGCWC 1 cut(s) 162
AoxI GGCC 2 cut(s) 170, 230
ApoI RAATTY 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 280
AsuHPI GGTGA 1 cut(s) 73
AvaII GGWCC 1 cut(s) 280
BalI TGGCCA 2 cut(s) 172, 232
Bbv12I GWGCWC 1 cut(s) 162
BccI CCATC 2 cut(s) 162, 267
BfmI CTRYAG 1 cut(s) 251
Bme18I GGWCC 1 cut(s) 280
BmgT120I GGNCC 1 cut(s) 280
Bsc4I CCNNNNNNNGG 2 cut(s) 179, 269
Bse3DI GCAATG 1 cut(s) 39
BseGI GGATG 2 cut(s) 173, 278
BseLI CCNNNNNNNGG 2 cut(s) 179, 269
BseMI GCAATG 1 cut(s) 39
BseMII CTCAG 1 cut(s) 69
BshFI GGCC 2 cut(s) 172, 232
BsiHKAI GWGCWC 1 cut(s) 162
BslI CCNNNNNNNGG 2 cut(s) 179, 269
BsnI GGCC 2 cut(s) 172, 232
Bsp1286I GDGCHC 1 cut(s) 162
Bsp143I GATC 1 cut(s) 299
BspANI GGCC 2 cut(s) 172, 232
BspCNI CTCAG 1 cut(s) 68
BspHI TCATGA 1 cut(s) 102
BspMAI CTGCAG 1 cut(s) 255
BsrDI GCAATG 1 cut(s) 39
BssMI GATC 1 cut(s) 299
Bst6I CTCTTC 2 cut(s) 53, 221
BstDEI CTNAG 1 cut(s) 55
BstF5I GGATG 2 cut(s) 173, 278
BstKTI GATC 1 cut(s) 302
BstMBI GATC 1 cut(s) 299
BstSFI CTRYAG 1 cut(s) 251
BsuRI GGCC 2 cut(s) 172, 232
BtsCI GGATG 2 cut(s) 173, 278
BtsI GCAGTG 1 cut(s) 89
BtsIMutI CAGTG 2 cut(s) 89, 226
CciI TCATGA 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 280
Csp6I GTAC 1 cut(s) 212
CviAII CATG 2 cut(s) 103, 184
CviJI RGCY 4 cut(s) 172, 225, 232, 289
CviKI_1 RGCY 4 cut(s) 172, 225, 232, 289
CviQI GTAC 1 cut(s) 212
DdeI CTNAG 1 cut(s) 55
DpnI GATC 1 cut(s) 301
DpnII GATC 1 cut(s) 299
EaeI YGGCCR 2 cut(s) 170, 230
Eam1104I CTCTTC 2 cut(s) 53, 221
EarI CTCTTC 2 cut(s) 53, 221
Eco47I GGWCC 1 cut(s) 280
Eco57I CTGAAG 1 cut(s) 202
FaeI CATG 2 cut(s) 106, 187
FaiI YATR 8 cut(s) 104, 164, 185, 199, 201, 292, 294, 307
FatI CATG 2 cut(s) 102, 183
FauNDI CATATG 1 cut(s) 199
FokI GGATG 2 cut(s) 180, 285
HaeIII GGCC 2 cut(s) 172, 232
Hin1II CATG 2 cut(s) 106, 187
HinfI GANTC 1 cut(s) 259
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 1 cut(s) 87
Hpy188III TCNNGA 1 cut(s) 103
Hpy8I GTNNAC 1 cut(s) 87
HpyCH4IV ACGT 1 cut(s) 109
HpyCH4V TGCA 3 cut(s) 32, 94, 253
HpyF3I CTNAG 1 cut(s) 55
HpySE526I ACGT 1 cut(s) 109
Hsp92II CATG 2 cut(s) 106, 187
Kzo9I GATC 1 cut(s) 299
LpnPI CCDG 3 cut(s) 42, 214, 254
MaeII ACGT 1 cut(s) 109
MaeIII GTNAC 1 cut(s) 61
MalI GATC 1 cut(s) 301
MboI GATC 1 cut(s) 299
MboII GAAGA 6 cut(s) 40, 43, 91, 142, 208, 268
MfeI CAATTG 2 cut(s) 72, 174
MhlI GDGCHC 1 cut(s) 162
MlsI TGGCCA 2 cut(s) 172, 232
MluCI AATT 6 cut(s) 72, 95, 115, 129, 174, 264
MluNI TGGCCA 2 cut(s) 172, 232
MmeI TCCRAC 1 cut(s) 307
MnlI CCTC 2 cut(s) 56, 187
Mox20I TGGCCA 2 cut(s) 172, 232
MscI TGGCCA 2 cut(s) 172, 232
MseI TTAA 3 cut(s) 68, 81, 120
Msp20I TGGCCA 2 cut(s) 172, 232
MunI CAATTG 2 cut(s) 72, 174
NdeI CATATG 1 cut(s) 199
NdeII GATC 1 cut(s) 299
NlaIII CATG 2 cut(s) 106, 187
NmuCI GTSAC 1 cut(s) 61
PagI TCATGA 1 cut(s) 102
PfeI GAWTC 1 cut(s) 259
PspPI GGNCC 1 cut(s) 280
PstI CTGCAG 1 cut(s) 255
RsaI GTAC 1 cut(s) 213
RsaNI GTAC 1 cut(s) 212
SaqAI TTAA 3 cut(s) 68, 81, 120
Sau3AI GATC 1 cut(s) 299
Sau96I GGNCC 1 cut(s) 280
SduI GDGCHC 1 cut(s) 162
SetI ASST 1 cut(s) 112
SfcI CTRYAG 1 cut(s) 251
SgeI CNNG 7 cut(s) 31, 41, 69, 115, 196, 241, 281
SinI GGWCC 1 cut(s) 280
Sse9I AATT 6 cut(s) 72, 95, 115, 129, 174, 264
TaiI ACGT 1 cut(s) 112
TasI AATT 6 cut(s) 72, 95, 115, 129, 174, 264
TatI WGTACW 1 cut(s) 211
TfiI GAWTC 1 cut(s) 259
Tru1I TTAA 3 cut(s) 68, 81, 120
Tru9I TTAA 3 cut(s) 68, 81, 120
TscAI CASTG 2 cut(s) 96, 226
TseFI GTSAC 1 cut(s) 61
Tsp45I GTSAC 1 cut(s) 61
TspDTI ATGAA 3 cut(s) 91, 119, 196
TspRI CASTG 2 cut(s) 96, 226
VpaK11BI GGWCC 1 cut(s) 280
XapI RAATTY 1 cut(s) 115
XcmI CCANNNNNNNNNTGG 1 cut(s) 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.