pycom14g01400

Phytosulfokines

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Reverse (-)
989345 .. 989735
391 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 240 bp
ATGAAGAATAACCAAAACTTTCTCATATTTTCTCTCTTTGTTTTTCTTCTTCTCTTCAACTCATCATCTGCTCGTGGTCGTCTTCTGCAACAAAACAAAGCTTCACTAACTGGAGCCGATGATATTGCAAATCTGATGGGAGCAGAAGAATGTGATGAAAATGATGAAGAGTGTCTGCAGAGAAGGATGATTGCTGAAGCTCACTTGGATTATATTTACACCCAAAACCATAAGCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.07

Weight (kDa)

4.92

Isoelectric Point (pI)

50.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PSK PF06404 30 - 79 1.2e-17 Phytosulfokine precursor protein (PSK)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 216
AgsI TTSAA 1 cut(s) 58
AluBI AGCT 2 cut(s) 101, 200
AluI AGCT 2 cut(s) 101, 200
BauI CACGAG 1 cut(s) 72
BbsI GAAGAC 1 cut(s) 74
BccI CCATC 1 cut(s) 130
BcgI CGANNNNNNTGC 2 cut(s) 107, 141
BfmI CTRYAG 1 cut(s) 176
BmiI GGNNCC 1 cut(s) 115
BpiI GAAGAC 1 cut(s) 74
BpmI CTGGAG 1 cut(s) 132
Bse1I ACTGG 1 cut(s) 115
BseGI GGATG 1 cut(s) 192
BseNI ACTGG 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 115
BspMAI CTGCAG 1 cut(s) 180
BsrI ACTGG 1 cut(s) 115
BssSI CACGAG 1 cut(s) 72
Bst2BI CACGAG 1 cut(s) 72
Bst6I CTCTTC 2 cut(s) 59, 162
BstF5I GGATG 1 cut(s) 192
BstSFI CTRYAG 1 cut(s) 176
BstV2I GAAGAC 1 cut(s) 74
BtsCI GGATG 1 cut(s) 192
CviJI RGCY 4 cut(s) 101, 116, 200, 235
CviKI_1 RGCY 4 cut(s) 101, 116, 200, 235
Eam1104I CTCTTC 2 cut(s) 59, 162
EarI CTCTTC 2 cut(s) 59, 162
Eco57I CTGAAG 1 cut(s) 216
FaiI YATR 4 cut(s) 26, 213, 231, 238
FokI GGATG 1 cut(s) 199
GsuI CTGGAG 1 cut(s) 132
HindIII AAGCTT 1 cut(s) 99
Hpy188I TCNGA 1 cut(s) 135
HpyAV CCTTC 1 cut(s) 177
HpyCH4V TGCA 3 cut(s) 88, 128, 178
LmnI GCTCC 2 cut(s) 113, 140
LpnPI CCDG 1 cut(s) 96
MboII GAAGA 7 cut(s) 16, 38, 41, 46, 74, 158, 179
NlaIV GGNNCC 1 cut(s) 115
PspN4I GGNNCC 1 cut(s) 115
PstI CTGCAG 1 cut(s) 180
SetI ASST 2 cut(s) 103, 202
SfcI CTRYAG 1 cut(s) 176
SgeI CNNG 4 cut(s) 84, 86, 123, 217
TspDTI ATGAA 3 cut(s) 17, 171, 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.