pycom14g07550

plant mutator transposase zinc finger

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Reverse (-)
7701133 .. 7701330
198 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGGAGACTGCTAGAATAGCAAGGTGTAGTTATCGTGCAATTACTGTTGTCTTTGCTTTGTTTGAACACAGTAAATATGCAGATATCTGTAAAGATATATGTTTAAGGTTTAAGAAACTGACAGTAGGGAGTTTCGAGCTAACATATTCTCTTCCCAATCATCCTACTTGCTGCAATCGGATATGGATGTGCATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.58

Weight (kDa)

8.86

Isoelectric Point (pI)

15.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 65
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
ApeKI GCWGC 1 cut(s) 171
BbvI GCAGC 1 cut(s) 158
BfaI CTAG 1 cut(s) 12
BisI GCNGC 1 cut(s) 172
BlsI GCNGC 1 cut(s) 173
BseGI GGATG 2 cut(s) 160, 192
BseXI GCAGC 1 cut(s) 158
Bst4CI ACNGT 3 cut(s) 46, 71, 124
Bst6I CTCTTC 1 cut(s) 156
BstF5I GGATG 2 cut(s) 160, 192
BstMWI GCNNNNNNNGC 1 cut(s) 17
BstV1I GCAGC 1 cut(s) 158
BtsCI GGATG 2 cut(s) 160, 192
CviJI RGCY 1 cut(s) 139
CviKI_1 RGCY 1 cut(s) 139
Eam1104I CTCTTC 1 cut(s) 156
EarI CTCTTC 1 cut(s) 156
Eco32I GATATC 1 cut(s) 85
EcoRV GATATC 1 cut(s) 85
FaiI YATR 5 cut(s) 78, 98, 100, 145, 184
Fnu4HI GCNGC 1 cut(s) 172
FokI GGATG 1 cut(s) 147
Fsp4HI GCNGC 1 cut(s) 172
FspBI CTAG 1 cut(s) 12
FspEI CC 9 cut(s) 7, 91, 111, 112, 163, 168, 169, 169, 177
GluI GCNGC 1 cut(s) 172
Hpy188I TCNGA 1 cut(s) 180
HpyCH4III ACNGT 3 cut(s) 46, 71, 124
HpyCH4V TGCA 4 cut(s) 38, 80, 174, 192
HpyF10VI GCNNNNNNNGC 1 cut(s) 17
Lsp1109I GCAGC 1 cut(s) 158
MaeI CTAG 1 cut(s) 12
MboII GAAGA 1 cut(s) 143
MluCI AATT 1 cut(s) 39
MseI TTAA 2 cut(s) 104, 111
MwoI GCNNNNNNNGC 1 cut(s) 17
PkrI GCNGC 1 cut(s) 173
SaqAI TTAA 2 cut(s) 104, 111
SatI GCNGC 1 cut(s) 172
SetI ASST 3 cut(s) 26, 110, 141
SgeI CNNG 5 cut(s) 24, 33, 47, 148, 180
Sse9I AATT 1 cut(s) 39
SspMI CTAG 1 cut(s) 12
TaaI ACNGT 3 cut(s) 46, 71, 124
TaqI TCGA 1 cut(s) 135
TasI AATT 1 cut(s) 39
Tru1I TTAA 2 cut(s) 104, 111
Tru9I TTAA 2 cut(s) 104, 111
TseI GCWGC 1 cut(s) 171
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.