pycom15g06310
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
3853252 .. 3853515
264 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 264 bp
ATGGTCCAGGAGCTTGTGAACAGTTTTCCAACCACTGGAAAGAACCGATGCTGGAAGAAAATTTTGGAAAATGGTCGTGATGTATTTCACAAAGATCGAACTCCGAATGATCTGAGAAATAAATGGGGAAAGATGCGGGTGAAAGGTGCGGTTGATCACTTTTTTAACTCTCCTCATCATCGTCATCATCGTCATCATTTTCGTAGATATTATCTAGCATCTTCGAGGATGGACCAACTGTTAGATTCTTCTCCTCGCTCTTAA

Protein Analysis

88

Amino Acids

10.51

Weight (kDa)

10.7

Isoelectric Point (pI)

51.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 35
AciI CCGC 2 cut(s) 136, 149
AcsI RAATTY 1 cut(s) 60
AfiI CCNNNNNNNGG 1 cut(s) 35
AjnI CCWGG 1 cut(s) 6
AjuI GAANNNNNNNTTGG 2 cut(s) 47, 79
AluBI AGCT 1 cut(s) 13
AluI AGCT 1 cut(s) 13
ApoI RAATTY 1 cut(s) 60
AspS9I GGNCC 2 cut(s) 4, 232
AsuHPI GGTGA 1 cut(s) 151
AvaII GGWCC 2 cut(s) 4, 232
BccI CCATC 1 cut(s) 223
BciT130I CCWGG 1 cut(s) 8
BclI TGATCA 1 cut(s) 154
BfaI CTAG 1 cut(s) 215
Bme1390I CCNGG 1 cut(s) 8
Bme18I GGWCC 2 cut(s) 4, 232
BmgT120I GGNCC 2 cut(s) 4, 232
BmrFI CCNGG 1 cut(s) 8
BmsI GCATC 3 cut(s) 38, 123, 227
Bsc4I CCNNNNNNNGG 1 cut(s) 35
Bse1I ACTGG 1 cut(s) 40
BseBI CCWGG 1 cut(s) 8
BseGI GGATG 1 cut(s) 234
BseLI CCNNNNNNNGG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 104
BseNI ACTGG 1 cut(s) 40
BseRI GAGGAG 2 cut(s) 162, 243
BslI CCNNNNNNNGG 1 cut(s) 35
Bsp143I GATC 3 cut(s) 94, 109, 154
BspACI CCGC 2 cut(s) 136, 149
BspCNI CTCAG 1 cut(s) 105
BsrI ACTGG 1 cut(s) 40
BssMI GATC 3 cut(s) 94, 109, 154
Bst2UI CCWGG 1 cut(s) 8
Bst4CI ACNGT 2 cut(s) 23, 240
BstDEI CTNAG 1 cut(s) 113
BstF5I GGATG 1 cut(s) 234
BstKTI GATC 3 cut(s) 97, 112, 157
BstMBI GATC 3 cut(s) 94, 109, 154
BstNI CCWGG 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 6
BtsCI GGATG 1 cut(s) 234
BtsIMutI CAGTG 1 cut(s) 33
Cfr13I GGNCC 2 cut(s) 4, 232
CviJI RGCY 1 cut(s) 13
CviKI_1 RGCY 1 cut(s) 13
DdeI CTNAG 1 cut(s) 113
DpnI GATC 3 cut(s) 96, 111, 156
DpnII GATC 3 cut(s) 94, 109, 154
Eco47I GGWCC 2 cut(s) 4, 232
EcoRII CCWGG 1 cut(s) 6
FauI CCCGC 1 cut(s) 129
FbaI TGATCA 1 cut(s) 154
FokI GGATG 1 cut(s) 241
FspBI CTAG 1 cut(s) 215
HinfI GANTC 1 cut(s) 245
HphI GGTGA 1 cut(s) 151
Hpy166II GTNNAC 1 cut(s) 19
Hpy188I TCNGA 2 cut(s) 105, 114
Hpy188III TCNNGA 1 cut(s) 77
Hpy8I GTNNAC 1 cut(s) 19
HpyCH4III ACNGT 2 cut(s) 23, 240
HpyF3I CTNAG 1 cut(s) 113
Ksp22I TGATCA 1 cut(s) 154
Kzo9I GATC 3 cut(s) 94, 109, 154
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 3 cut(s) 20, 21, 37
LweI GCATC 3 cut(s) 38, 123, 227
MaeI CTAG 1 cut(s) 215
MalI GATC 3 cut(s) 96, 111, 156
MboI GATC 3 cut(s) 94, 109, 154
MboII GAAGA 3 cut(s) 67, 213, 240
MluCI AATT 1 cut(s) 60
MmeI TCCRAC 1 cut(s) 53
MnlI CCTC 3 cut(s) 183, 219, 264
MseI TTAA 2 cut(s) 165, 262
MspR9I CCNGG 1 cut(s) 8
MvaI CCWGG 1 cut(s) 8
NdeII GATC 3 cut(s) 94, 109, 154
PcsI WCGNNNNNNNCGW 1 cut(s) 187
PfeI GAWTC 1 cut(s) 245
PflMI CCANNNNNTGG 1 cut(s) 35
PfoI TCCNGGA 1 cut(s) 6
Psp6I CCWGG 1 cut(s) 6
PspGI CCWGG 1 cut(s) 6
PspPI GGNCC 2 cut(s) 4, 232
SaqAI TTAA 2 cut(s) 165, 262
Sau3AI GATC 3 cut(s) 94, 109, 154
Sau96I GGNCC 2 cut(s) 4, 232
ScrFI CCNGG 1 cut(s) 8
SetI ASST 2 cut(s) 15, 148
SfaNI GCATC 3 cut(s) 38, 123, 227
SgeI CNNG 9 cut(s) 19, 20, 26, 48, 64, 89, 149, 227, 237
SinI GGWCC 2 cut(s) 4, 232
Sse9I AATT 1 cut(s) 60
SsiI CCGC 2 cut(s) 136, 149
SspMI CTAG 1 cut(s) 215
StyD4I CCNGG 1 cut(s) 6
TaaI ACNGT 2 cut(s) 23, 240
TaqI TCGA 2 cut(s) 97, 224
TasI AATT 1 cut(s) 60
TfiI GAWTC 1 cut(s) 245
Tru1I TTAA 2 cut(s) 165, 262
Tru9I TTAA 2 cut(s) 165, 262
TscAI CASTG 1 cut(s) 40
TspRI CASTG 1 cut(s) 40
Van91I CCANNNNNTGG 1 cut(s) 35
VpaK11BI GGWCC 2 cut(s) 4, 232
XapI RAATTY 1 cut(s) 60
XspI CTAG 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.