pycom15g26840

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
22053831 .. 22054157
327 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 327 bp
ATGGTTGGAAAGCTACGGATGTTTATTTTCTGGATCATTTCACGGATTGTTAATACCATTTTTCTAGAAGAAGTTATGGCCGTTTTAACACTAAAAGGTTTCCAAGAGGCTGAGCAGTTTGTAACTGACAAGAAAGCATTGAAAGCAATAAATCCAATAAAACTAACAGCCAAAACTAATGCAGCCAAGAACAAGCCAGCTAACACCTATTCAAATATCAGAGGAAATGGAAAATTAAGTGAGAGTAATGGGCATAAAGGCTGCCCAAAGAGTTACAATTGTTTTAGCATTTCCTCTCACTTATTGTCATCACTAAATGGCTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

109

Amino Acids

11.94

Weight (kDa)

9.8

Isoelectric Point (pI)

18.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 41
AcoI YGGCCR 1 cut(s) 78
AgsI TTSAA 2 cut(s) 142, 213
AluBI AGCT 2 cut(s) 13, 200
AluI AGCT 2 cut(s) 13, 200
AlwI GGATC 1 cut(s) 41
AoxI GGCC 1 cut(s) 78
ApeKI GCWGC 2 cut(s) 182, 261
BbvI GCAGC 2 cut(s) 194, 248
BceAI ACGGC 1 cut(s) 65
BfaI CTAG 1 cut(s) 65
BisI GCNGC 2 cut(s) 183, 262
BlpI GCTNAGC 1 cut(s) 111
BlsI GCNGC 2 cut(s) 184, 263
Bpu1102I GCTNAGC 1 cut(s) 111
BseGI GGATG 1 cut(s) 24
BseMII CTCAG 1 cut(s) 102
BseXI GCAGC 2 cut(s) 194, 248
BshFI GGCC 1 cut(s) 80
BsnI GGCC 1 cut(s) 80
Bsp143I GATC 1 cut(s) 33
Bsp1720I GCTNAGC 1 cut(s) 111
BspANI GGCC 1 cut(s) 80
BspCNI CTCAG 1 cut(s) 103
BspPI GGATC 1 cut(s) 41
BssMI GATC 1 cut(s) 33
BstC8I GCNNGC 1 cut(s) 198
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 24
BstKTI GATC 1 cut(s) 36
BstMBI GATC 1 cut(s) 33
BstMWI GCNNNNNNNGC 1 cut(s) 143
BstV1I GCAGC 2 cut(s) 194, 248
BsuRI GGCC 1 cut(s) 80
BtsCI GGATG 1 cut(s) 24
Cac8I GCNNGC 1 cut(s) 198
CviJI RGCY 9 cut(s) 13, 80, 110, 170, 185, 196, 200, 261, 321
CviKI_1 RGCY 9 cut(s) 13, 80, 110, 170, 185, 196, 200, 261, 321
DdeI CTNAG 1 cut(s) 111
DpnI GATC 1 cut(s) 35
DpnII GATC 1 cut(s) 33
EaeI YGGCCR 1 cut(s) 78
FaiI YATR 2 cut(s) 77, 255
Fnu4HI GCNGC 2 cut(s) 183, 262
FokI GGATG 1 cut(s) 31
Fsp4HI GCNGC 2 cut(s) 183, 262
FspBI CTAG 1 cut(s) 65
GluI GCNGC 2 cut(s) 183, 262
HaeIII GGCC 1 cut(s) 80
Hpy188I TCNGA 1 cut(s) 221
Hpy188III TCNNGA 2 cut(s) 31, 65
HpyCH4V TGCA 1 cut(s) 182
HpyF10VI GCNNNNNNNGC 1 cut(s) 143
HpyF3I CTNAG 1 cut(s) 111
Kzo9I GATC 1 cut(s) 33
LpnPI CCDG 2 cut(s) 16, 210
Lsp1109I GCAGC 2 cut(s) 194, 248
MaeI CTAG 1 cut(s) 65
MaeIII GTNAC 2 cut(s) 121, 272
MalI GATC 1 cut(s) 35
MboI GATC 1 cut(s) 33
MboII GAAGA 1 cut(s) 80
MfeI CAATTG 1 cut(s) 277
MluCI AATT 2 cut(s) 233, 277
MnlI CCTC 3 cut(s) 100, 215, 304
MseI TTAA 3 cut(s) 51, 86, 236
MunI CAATTG 1 cut(s) 277
MwoI GCNNNNNNNGC 1 cut(s) 143
NdeII GATC 1 cut(s) 33
PkrI GCNGC 2 cut(s) 184, 263
SaqAI TTAA 3 cut(s) 51, 86, 236
SatI GCNGC 2 cut(s) 183, 262
Sau3AI GATC 1 cut(s) 33
SetI ASST 4 cut(s) 15, 100, 202, 209
SgeI CNNG 8 cut(s) 43, 54, 77, 116, 142, 199, 205, 209
Sse9I AATT 2 cut(s) 233, 277
SspMI CTAG 1 cut(s) 65
TasI AATT 2 cut(s) 233, 277
Tru1I TTAA 3 cut(s) 51, 86, 236
Tru9I TTAA 3 cut(s) 51, 86, 236
TseI GCWGC 2 cut(s) 182, 261
TspGWI ACGGA 2 cut(s) 31, 58
XbaI TCTAGA 1 cut(s) 64
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.