pycom16g02600

ABC transporter G family member

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
1711493 .. 1711684
192 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGCTGGTCCTACACCTGATGAACCACCAGCATACTTCTCACAAAAGAGTAGATGCTCCTGTTGAGTCATTTTCACAACATTCGTCACTAGTTCTCCATGCAACTCGGATCACAAGAAGGGAAGTGTCCGACAAAGAAACAAAGTTCAGCAAGAAAAACAGAGTCCTGAAGAAGGGAGGTTGGTGGAGGTAA

Protein Analysis

64

Amino Acids

7.46

Weight (kDa)

11.04

Isoelectric Point (pI)

39.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 116
AcuI CTGAAG 1 cut(s) 188
AfiI CCNNNNNNNGG 1 cut(s) 172
AhlI ACTAGT 1 cut(s) 88
AlwI GGATC 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 7
AvaII GGWCC 1 cut(s) 7
BcuI ACTAGT 1 cut(s) 88
BfaI CTAG 1 cut(s) 89
Bme18I GGWCC 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 7
BmsI GCATC 1 cut(s) 43
BsaXI ACNNNNNCTCC 2 cut(s) 78, 108
Bsc4I CCNNNNNNNGG 1 cut(s) 172
BseLI CCNNNNNNNGG 1 cut(s) 172
BslI CCNNNNNNNGG 1 cut(s) 172
Bsp143I GATC 1 cut(s) 108
BspPI GGATC 1 cut(s) 116
BssMI GATC 1 cut(s) 108
BstENI CCTNNNNNAGG 1 cut(s) 170
BstKTI GATC 1 cut(s) 111
BstMBI GATC 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 7
CviAII CATG 1 cut(s) 98
DpnI GATC 1 cut(s) 110
DpnII GATC 1 cut(s) 108
Eco47I GGWCC 1 cut(s) 7
Eco57I CTGAAG 1 cut(s) 188
EcoNI CCTNNNNNAGG 1 cut(s) 170
FaeI CATG 1 cut(s) 101
FaiI YATR 2 cut(s) 33, 99
FatI CATG 1 cut(s) 97
FspBI CTAG 1 cut(s) 89
Hin1II CATG 1 cut(s) 101
HinfI GANTC 2 cut(s) 65, 162
Hpy188I TCNGA 2 cut(s) 108, 130
Hpy188III TCNNGA 1 cut(s) 166
HpyAV CCTTC 2 cut(s) 111, 166
HpyCH4V TGCA 1 cut(s) 101
Hsp92II CATG 1 cut(s) 101
Kzo9I GATC 1 cut(s) 108
LmnI GCTCC 1 cut(s) 61
LpnPI CCDG 4 cut(s) 29, 41, 72, 179
LweI GCATC 1 cut(s) 43
MaeI CTAG 1 cut(s) 89
MaeIII GTNAC 1 cut(s) 84
MalI GATC 1 cut(s) 110
MboI GATC 1 cut(s) 108
MboII GAAGA 1 cut(s) 181
MlyI GAGTC 2 cut(s) 74, 171
MmeI TCCRAC 1 cut(s) 153
MnlI CCTC 2 cut(s) 170, 180
NdeII GATC 1 cut(s) 108
NlaIII CATG 1 cut(s) 101
NmuCI GTSAC 1 cut(s) 84
PleI GAGTC 2 cut(s) 73, 170
PpsI GAGTC 2 cut(s) 73, 170
PspPI GGNCC 1 cut(s) 7
Sau3AI GATC 1 cut(s) 108
Sau96I GGNCC 1 cut(s) 7
SchI GAGTC 2 cut(s) 74, 171
SetI ASST 3 cut(s) 18, 181, 191
SfaNI GCATC 1 cut(s) 43
SinI GGWCC 1 cut(s) 7
SpeI ACTAGT 1 cut(s) 88
SspMI CTAG 1 cut(s) 89
TseFI GTSAC 1 cut(s) 84
Tsp45I GTSAC 1 cut(s) 84
TspDTI ATGAA 1 cut(s) 35
VpaK11BI GGWCC 1 cut(s) 7
XagI CCTNNNNNAGG 1 cut(s) 170
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.