Rh4CG052700

ABC transporter G family member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
10463810 .. 10465570
1761 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG052700.1

Sequence Viewer

Length: 189 bp
ATGTGCTTAGATTTGAAAGGGCTCTGCATCAACGAGTTTCGCAGTCTTCAATTTGAGCATCAACATTCTTTTGATATTCAAGATGGAGAACAAGCACTTGAACGCATCTCCTTTAGAGGAAGTCATATTAGGGAAACCGTGGTAGCTCAAAGTAGAATACTGTTGTTTTGGTATTGCTCCACTTACTAA

Protein Analysis

62

Amino Acids

7.37

Weight (kDa)

5.81

Isoelectric Point (pI)

46.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 4 cut(s) 16, 50, 80, 101
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
BanII GRGCYC 1 cut(s) 24
BbsI GAAGAC 1 cut(s) 38
BccI CCATC 1 cut(s) 77
BmsI GCATC 3 cut(s) 36, 67, 114
BpiI GAAGAC 1 cut(s) 38
BsaJI CCNNGG 1 cut(s) 138
BseDI CCNNGG 1 cut(s) 138
Bsp1286I GDGCHC 1 cut(s) 24
BssECI CCNNGG 1 cut(s) 138
Bst4CI ACNGT 2 cut(s) 139, 162
BstDEI CTNAG 1 cut(s) 7
BstDSI CCRYGG 1 cut(s) 138
BstV2I GAAGAC 1 cut(s) 38
BtgI CCRYGG 1 cut(s) 138
CviJI RGCY 2 cut(s) 22, 146
CviKI_1 RGCY 2 cut(s) 22, 146
DdeI CTNAG 1 cut(s) 7
Eco24I GRGCYC 1 cut(s) 24
EcoT38I GRGCYC 1 cut(s) 24
FaiI YATR 1 cut(s) 126
FriOI GRGCYC 1 cut(s) 24
Hpy188III TCNNGA 1 cut(s) 80
HpyCH4III ACNGT 2 cut(s) 139, 162
HpyCH4V TGCA 1 cut(s) 27
HpyF3I CTNAG 1 cut(s) 7
LmnI GCTCC 1 cut(s) 182
LweI GCATC 3 cut(s) 36, 67, 114
MboII GAAGA 1 cut(s) 38
MhlI GDGCHC 1 cut(s) 24
MluCI AATT 1 cut(s) 50
MnlI CCTC 1 cut(s) 110
SduI GDGCHC 1 cut(s) 24
SetI ASST 1 cut(s) 148
SfaNI GCATC 3 cut(s) 36, 67, 114
SgeI CNNG 5 cut(s) 46, 92, 104, 110, 151
Sse9I AATT 1 cut(s) 50
TaaI ACNGT 2 cut(s) 139, 162
TasI AATT 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.