Rroxscaffold_6G00425080

ABC transporter G family member

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
46098459 .. 46099706
1248 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00425080.1

Sequence Viewer

Length: 165 bp
ATGGAACGGAAAGGAGGGGAAGAAGAGGCACTTGAGCGTATCTCCTTTGGAGGAAGTCATATTAGGGAAACTGTGGTAGCTCAAAGTAGAATACTATTGTTTTGGTATTGCACCACTTACCGATTCATATATATGTGGAGTGCCATGGAGATGTTTATCGAGTAG

Protein Analysis

54

Amino Acids

6.5

Weight (kDa)

5.31

Isoelectric Point (pI)

66.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
BplI GAGNNNNNCTC 2 cut(s) 26, 58
BpuEI CTTGAG 1 cut(s) 53
BsaBI GATNNNNATC 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 144
Bse8I GATNNNNATC 1 cut(s) 155
BseDI CCNNGG 1 cut(s) 144
BseJI GATNNNNATC 1 cut(s) 155
Bsp19I CCATGG 1 cut(s) 144
BssECI CCNNGG 1 cut(s) 144
BssT1I CCWWGG 1 cut(s) 144
Bst4CI ACNGT 1 cut(s) 73
Bst6I CTCTTC 1 cut(s) 18
BstDSI CCRYGG 1 cut(s) 144
BtgI CCRYGG 1 cut(s) 144
CviAII CATG 1 cut(s) 145
CviJI RGCY 1 cut(s) 80
CviKI_1 RGCY 1 cut(s) 80
Eam1104I CTCTTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 18
Eco130I CCWWGG 1 cut(s) 144
EcoT14I CCWWGG 1 cut(s) 144
ErhI CCWWGG 1 cut(s) 144
FaeI CATG 1 cut(s) 148
FaiI YATR 6 cut(s) 60, 128, 130, 132, 134, 146
FalI AAGNNNNNCTT 2 cut(s) 15, 47
FatI CATG 1 cut(s) 144
Hin1II CATG 1 cut(s) 148
HinfI GANTC 1 cut(s) 123
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4V TGCA 1 cut(s) 111
Hsp92II CATG 1 cut(s) 148
MboII GAAGA 2 cut(s) 32, 35
MnlI CCTC 3 cut(s) 8, 19, 44
MslI CAYNNNNRTG 2 cut(s) 131, 149
NcoI CCATGG 1 cut(s) 144
NlaIII CATG 1 cut(s) 148
PfeI GAWTC 1 cut(s) 123
RseI CAYNNNNRTG 2 cut(s) 131, 149
SetI ASST 1 cut(s) 82
SgeI CNNG 2 cut(s) 44, 157
SmiMI CAYNNNNRTG 2 cut(s) 131, 149
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
StyI CCWWGG 1 cut(s) 144
TaaI ACNGT 1 cut(s) 73
TaqI TCGA 1 cut(s) 159
TfiI GAWTC 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 115
TspGWI ACGGA 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.