pycom16g06700

SNF1-related protein kinase regulatory subunit gamma-1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0003883
Physical Location & Seq
Reverse (-)
4337185 .. 4337622
438 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g06700.2

Sequence Viewer

Length: 348 bp
ATGAACCCTTCAAGTCAACCACAGTTTCAGGTGAGGTCAATACTTAAAGTTAAATCCTTCTGCTGGGCGCCTTTCATTCCAGTTGCAACCGATAGTTCAATGTTGACCGTTATGCTACTACTTTCAAAATATAGGCTGAGGAATGTACCTGTAATAGAACCAGGCCAACCCATCATTAAGAACTACATTACCCAGTCAGGACTTATTCAGGGTCTTGAGAGATGCAGAGGAAGGGACTGGTTTGACTACATTGCGGCAAAGCCTATCTCCGATTTTGGACTTCCTTTCATGTCCTCTGATGAGGTAAGGTTGCCTGGTTACCAAAACAATATTCTTAATGGCTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CBS

Protein Analysis

116

Amino Acids

13.11

Weight (kDa)

9.34

Isoelectric Point (pI)

57.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 67
AciI CCGC 1 cut(s) 254
AcyI GRCGYC 1 cut(s) 68
AfaI GTAC 1 cut(s) 147
AfiI CCNNNNNNNGG 1 cut(s) 63
AgsI TTSAA 3 cut(s) 12, 99, 126
AjnI CCWGG 2 cut(s) 160, 313
AjuI GAANNNNNNNTTGG 2 cut(s) 315, 347
AoxI GGCC 1 cut(s) 163
AspLEI GCGC 1 cut(s) 70
AsuHPI GGTGA 1 cut(s) 43
BanI GGYRCC 1 cut(s) 67
BbvCI CCTCAGC 1 cut(s) 137
BccI CCATC 1 cut(s) 179
BciT130I CCWGG 2 cut(s) 162, 315
BfoI RGCGCY 1 cut(s) 71
BisI GCNGC 1 cut(s) 255
BlsI GCNGC 1 cut(s) 256
Bme1390I CCNGG 2 cut(s) 162, 315
BmiI GGNNCC 1 cut(s) 69
BmrFI CCNGG 2 cut(s) 162, 315
BmrI ACTGGG 1 cut(s) 187
BmsI GCATC 1 cut(s) 212
BmuI ACTGGG 1 cut(s) 187
Bpu10I CCTNAGC 1 cut(s) 137
BpuEI CTTGAG 1 cut(s) 236
BsaHI GRCGYC 1 cut(s) 68
Bsc4I CCNNNNNNNGG 1 cut(s) 63
Bse1I ACTGG 3 cut(s) 80, 193, 242
Bse3DI GCAATG 1 cut(s) 249
BseBI CCWGG 2 cut(s) 162, 315
BseLI CCNNNNNNNGG 1 cut(s) 63
BseMI GCAATG 1 cut(s) 249
BseMII CTCAG 1 cut(s) 128
BseNI ACTGG 3 cut(s) 80, 193, 242
BseYI CCCAGC 1 cut(s) 63
BshFI GGCC 1 cut(s) 165
BshNI GGYRCC 1 cut(s) 67
BslFI GGGAC 1 cut(s) 248
BslI CCNNNNNNNGG 1 cut(s) 63
BsmFI GGGAC 1 cut(s) 248
BsnI GGCC 1 cut(s) 165
BspACI CCGC 1 cut(s) 254
BspANI GGCC 1 cut(s) 165
BspCNI CTCAG 1 cut(s) 129
BspLI GGNNCC 1 cut(s) 69
BspT107I GGYRCC 1 cut(s) 67
BsrDI GCAATG 1 cut(s) 249
BsrI ACTGG 3 cut(s) 80, 193, 242
BssNI GRCGYC 1 cut(s) 68
Bst2UI CCWGG 2 cut(s) 162, 315
Bst4CI ACNGT 2 cut(s) 24, 109
BstACI GRCGYC 1 cut(s) 68
BstDEI CTNAG 1 cut(s) 137
BstEII GGTNACC 1 cut(s) 317
BstH2I RGCGCY 1 cut(s) 71
BstHHI GCGC 1 cut(s) 70
BstNI CCWGG 2 cut(s) 162, 315
BstPI GGTNACC 1 cut(s) 317
BstSCI CCNGG 2 cut(s) 160, 313
BsuRI GGCC 1 cut(s) 165
CfoI GCGC 1 cut(s) 70
Csp6I GTAC 1 cut(s) 146
CviAII CATG 1 cut(s) 289
CviJI RGCY 4 cut(s) 136, 165, 262, 342
CviKI_1 RGCY 4 cut(s) 136, 165, 262, 342
CviQI GTAC 1 cut(s) 146
DdeI CTNAG 1 cut(s) 137
DinI GGCGCC 1 cut(s) 69
Eco91I GGTNACC 1 cut(s) 317
EcoO65I GGTNACC 1 cut(s) 317
EcoRII CCWGG 2 cut(s) 160, 313
EgeI GGCGCC 1 cut(s) 69
EheI GGCGCC 1 cut(s) 69
FaeI CATG 1 cut(s) 292
FaiI YATR 3 cut(s) 113, 132, 290
FaqI GGGAC 1 cut(s) 248
FatI CATG 1 cut(s) 288
Fnu4HI GCNGC 1 cut(s) 255
Fsp4HI GCNGC 1 cut(s) 255
GlaI GCGC 1 cut(s) 69
GluI GCNGC 1 cut(s) 255
GsaI CCCAGC 1 cut(s) 67
HaeII RGCGCY 1 cut(s) 71
HaeIII GGCC 1 cut(s) 165
HhaI GCGC 1 cut(s) 70
Hin1I GRCGYC 1 cut(s) 68
Hin1II CATG 1 cut(s) 292
Hin6I GCGC 1 cut(s) 68
HinP1I GCGC 1 cut(s) 68
HincII GTYRAC 2 cut(s) 17, 105
HindII GTYRAC 2 cut(s) 17, 105
HphI GGTGA 1 cut(s) 43
Hpy166II GTNNAC 2 cut(s) 17, 105
Hpy188I TCNGA 2 cut(s) 271, 298
Hpy188III TCNNGA 2 cut(s) 198, 215
Hpy8I GTNNAC 2 cut(s) 17, 105
HpyAV CCTTC 3 cut(s) 18, 67, 225
HpyCH4III ACNGT 2 cut(s) 24, 109
HpyCH4V TGCA 2 cut(s) 86, 225
HpyF3I CTNAG 1 cut(s) 137
Hsp92I GRCGYC 1 cut(s) 68
Hsp92II CATG 1 cut(s) 292
HspAI GCGC 1 cut(s) 68
KasI GGCGCC 1 cut(s) 67
LweI GCATC 1 cut(s) 212
MaeIII GTNAC 1 cut(s) 317
Mly113I GGCGCC 1 cut(s) 68
MnlI CCTC 5 cut(s) 27, 132, 221, 295, 304
MseI TTAA 4 cut(s) 45, 51, 177, 336
MspR9I CCNGG 2 cut(s) 162, 315
MvaI CCWGG 2 cut(s) 162, 315
NarI GGCGCC 1 cut(s) 68
NlaIII CATG 1 cut(s) 292
NlaIV GGNNCC 1 cut(s) 69
PkrI GCNGC 1 cut(s) 256
PluTI GGCGCC 1 cut(s) 71
Psp6I CCWGG 2 cut(s) 160, 313
PspEI GGTNACC 1 cut(s) 317
PspFI CCCAGC 1 cut(s) 63
PspGI CCWGG 2 cut(s) 160, 313
PspN4I GGNNCC 1 cut(s) 69
RsaI GTAC 1 cut(s) 147
RsaNI GTAC 1 cut(s) 146
SaqAI TTAA 4 cut(s) 45, 51, 177, 336
SatI GCNGC 1 cut(s) 255
ScrFI CCNGG 2 cut(s) 162, 315
SetI ASST 5 cut(s) 33, 38, 151, 306, 311
SfaNI GCATC 1 cut(s) 212
SfoI GGCGCC 1 cut(s) 69
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
SsiI CCGC 1 cut(s) 254
SspDI GGCGCC 1 cut(s) 67
SspI AATATT 1 cut(s) 331
StyD4I CCNGG 2 cut(s) 160, 313
TaaI ACNGT 2 cut(s) 24, 109
TauI GCSGC 1 cut(s) 257
Tru1I TTAA 4 cut(s) 45, 51, 177, 336
Tru9I TTAA 4 cut(s) 45, 51, 177, 336
TspDTI ATGAA 3 cut(s) 17, 64, 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.